ID: 999776742

View in Genome Browser
Species Human (GRCh38)
Location 5:154817991-154818013
Sequence ACTTTTCCACAGGGGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999776734_999776742 -8 Left 999776734 5:154817976-154817998 CCCCTCTATGAACAGACTTTTCC No data
Right 999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG No data
999776735_999776742 -9 Left 999776735 5:154817977-154817999 CCCTCTATGAACAGACTTTTCCA No data
Right 999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG No data
999776736_999776742 -10 Left 999776736 5:154817978-154818000 CCTCTATGAACAGACTTTTCCAC No data
Right 999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG No data
999776733_999776742 -2 Left 999776733 5:154817970-154817992 CCACAACCCCTCTATGAACAGAC No data
Right 999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999776742 Original CRISPR ACTTTTCCACAGGGGGGTGA AGG Intergenic
No off target data available for this crispr