ID: 999783015

View in Genome Browser
Species Human (GRCh38)
Location 5:154866116-154866138
Sequence GATGCCCAGTTAAACAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999783015_999783020 27 Left 999783015 5:154866116-154866138 CCTGCTTTGTTTAACTGGGCATC 0: 1
1: 0
2: 1
3: 5
4: 120
Right 999783020 5:154866166-154866188 CTTTTTTTCCTGTCAATACAGGG No data
999783015_999783018 -2 Left 999783015 5:154866116-154866138 CCTGCTTTGTTTAACTGGGCATC 0: 1
1: 0
2: 1
3: 5
4: 120
Right 999783018 5:154866137-154866159 TCGGGAGTGTTTCATGATTTAGG 0: 1
1: 0
2: 0
3: 6
4: 91
999783015_999783019 26 Left 999783015 5:154866116-154866138 CCTGCTTTGTTTAACTGGGCATC 0: 1
1: 0
2: 1
3: 5
4: 120
Right 999783019 5:154866165-154866187 TCTTTTTTTCCTGTCAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999783015 Original CRISPR GATGCCCAGTTAAACAAAGC AGG (reversed) Intronic
902471969 1:16654710-16654732 AATCTCCAGTTAAACCAAGCTGG + Intergenic
902486833 1:16752736-16752758 AATCTCCAGTTAAACCAAGCTGG - Intronic
902843569 1:19091928-19091950 GGTGAACAGTTAAACAAACCTGG + Intronic
911407165 1:97456657-97456679 GATGCTCAGGTAAACAATGATGG + Intronic
911476207 1:98376296-98376318 CATGCCCAATTAATAAAAGCAGG + Intergenic
913475284 1:119231101-119231123 GAAGCCCAGTTATACAAATTAGG + Intergenic
916282487 1:163067626-163067648 GGTGCCCAGGTAAACAAAGAAGG + Intergenic
923747540 1:236716447-236716469 GAAGCCAAGTTAAAAGAAGCTGG + Intronic
1064454591 10:15474825-15474847 GATGCCAAGTGAAAAAAATCAGG - Intergenic
1065037429 10:21654038-21654060 GAAGCCAAGTTAAAGAAAGGTGG + Intronic
1075843721 10:125527971-125527993 AAAGCTAAGTTAAACAAAGCTGG - Intergenic
1079611460 11:22437383-22437405 GACACCCAGCTACACAAAGCAGG - Intergenic
1080005590 11:27402752-27402774 GATGCCTTCTTAAAGAAAGCTGG + Intronic
1081333168 11:41829490-41829512 GAAGCCCATTTCAACAAATCGGG - Intergenic
1086690143 11:89780557-89780579 TATACCCAGTTAACCAAAACTGG + Intergenic
1086715711 11:90059400-90059422 TATACCCAGTTAACCAAAACTGG - Intergenic
1091083633 11:132697547-132697569 TATTCCAAGTAAAACAAAGCGGG - Intronic
1093169012 12:15838053-15838075 AATGCACAGTAAAATAAAGCAGG + Intronic
1095194050 12:39291424-39291446 GATGTCCAGTCAAACAAAAGGGG + Intergenic
1098871206 12:75819325-75819347 AATGCCTAGTGAAAGAAAGCTGG + Intergenic
1100662721 12:96717555-96717577 GAAGCCCAGTTGAATGAAGCAGG + Intronic
1100920489 12:99479601-99479623 TATGCTAAGTTAAACAAACCAGG + Intronic
1101508133 12:105366665-105366687 GGTGTCCAGTCAAACAAAGACGG + Exonic
1104093455 12:125535348-125535370 GACTCCCAGTTAAACACAGTGGG - Intronic
1105627407 13:22126138-22126160 TATGCCCAGTGAAACAAAGCGGG + Intergenic
1107757274 13:43638048-43638070 GAGGACGAGTTGAACAAAGCAGG - Intronic
1109032568 13:57211059-57211081 GATGACCAGGTAGGCAAAGCTGG - Intergenic
1109092595 13:58068130-58068152 GAGTCCCATTCAAACAAAGCTGG - Intergenic
1109160649 13:58969506-58969528 GATTCCCAGTTCCACACAGCTGG - Intergenic
1110948046 13:81449106-81449128 AATGCCCCTTTGAACAAAGCAGG - Intergenic
1112738791 13:102451037-102451059 GATGCACAGTTCACCACAGCTGG - Intergenic
1114853225 14:26405823-26405845 TATGCCCATTTAAATAAAGCAGG - Intergenic
1116041239 14:39688413-39688435 AATGCCCAGGTAAAGAAACCAGG - Intergenic
1117176424 14:53151920-53151942 GATCCCCAGGTGGACAAAGCTGG + Intronic
1119782610 14:77287250-77287272 GATGTCCACTTAAAAAAATCTGG - Intronic
1120521982 14:85534390-85534412 GCTGTCCAGCTAAACGAAGCAGG - Intronic
1121558127 14:94854004-94854026 GATGCCCAGGTAACCCCAGCTGG + Intergenic
1124008459 15:25813486-25813508 GATTTCCAGTGAAAAAAAGCAGG + Intronic
1124654605 15:31498201-31498223 GGTGCCCAGTTACACAGAGAGGG - Intronic
1125864256 15:43029540-43029562 GATTCCCAGTGAAATAAAGAGGG - Intronic
1131185655 15:90271809-90271831 GATGCCTCGTGAAACACAGCTGG + Exonic
1133636713 16:7673319-7673341 GATGCTCAGTTAAATTAAACTGG - Intronic
1138119479 16:54387608-54387630 GATGCTCAGTTAAAGAAAATTGG - Intergenic
1138490231 16:57372325-57372347 GAAGCCCAGGGACACAAAGCCGG + Intergenic
1149016540 17:51914876-51914898 GATGGCCAGTTTTACAAACCAGG - Intronic
1151252626 17:72848796-72848818 GATGCCCACATAAAGAAGGCAGG + Intronic
1153077144 18:1176095-1176117 GTTGCCCATTTAAACAAATTGGG + Intergenic
1153451211 18:5231706-5231728 GATGTCTAGTTCAACAAGGCTGG + Intergenic
1158070776 18:53467989-53468011 GATGCCCAGTCCAACAATCCTGG + Exonic
1162004648 19:7769700-7769722 CATGCCCAGATGAACCAAGCAGG + Intergenic
1163222205 19:15929691-15929713 GATGCCCAGATAAAACATGCTGG + Intronic
1202704368 1_KI270713v1_random:11504-11526 AATCTCCAGTTAAACCAAGCTGG + Intergenic
926202096 2:10808675-10808697 GATGCCAGGCTAACCAAAGCGGG + Intronic
926550384 2:14294193-14294215 GTTCCTCATTTAAACAAAGCAGG - Intergenic
933272650 2:80249776-80249798 GATGCTTAGTGAAATAAAGCAGG - Intronic
935896250 2:107740796-107740818 GAAGCCAAGTAACACAAAGCAGG + Intergenic
938337459 2:130512172-130512194 GATACAAAGGTAAACAAAGCAGG - Intergenic
938352379 2:130608563-130608585 GATACAAAGGTAAACAAAGCAGG + Intergenic
941925721 2:170892345-170892367 GATGCCAAGTTTAATTAAGCAGG - Intergenic
946627461 2:221629180-221629202 AATGCCCACTTAAATATAGCAGG + Intergenic
1170131867 20:13029424-13029446 CATGCCTGGTTATACAAAGCTGG + Intronic
1177812750 21:25942259-25942281 GTTGCCAAGTTAAACAAAACTGG - Intronic
1178161123 21:29915853-29915875 GATCCACAGATAAACAAAGAGGG - Intronic
952821174 3:37487284-37487306 TATGGCCAGTTAAACAGAGAGGG + Intronic
956662913 3:71616911-71616933 GATCCCCAGCTGAACCAAGCAGG + Intergenic
958972062 3:100622572-100622594 TTTGCCCACTTAAAAAAAGCGGG + Intronic
959910467 3:111758274-111758296 GTTGCTTAGGTAAACAAAGCAGG - Intronic
960204431 3:114878066-114878088 AATGGACAGTTAAACAAAGTAGG - Intronic
960547927 3:118938340-118938362 GCTGCCCCTTTAGACAAAGCAGG + Intronic
960804748 3:121572712-121572734 GATGAACAGATGAACAAAGCTGG + Intronic
961213425 3:125142314-125142336 GATGGGCAATTAAACACAGCAGG + Intronic
964089555 3:152858196-152858218 AATGCCCAGAGAAACAAAGAAGG + Intergenic
964187724 3:153966601-153966623 GATGAGCAGTTAAACAATGAGGG + Intergenic
964679512 3:159322188-159322210 GATGCTCAGTTAGACAATTCAGG - Intronic
965523616 3:169693402-169693424 AATGCCCATGTAAACAAAGATGG - Intergenic
967298911 3:187993007-187993029 GATACCAAGGCAAACAAAGCAGG + Intergenic
970021742 4:11577106-11577128 GACACCCAGTTAAGAAAAGCTGG - Intergenic
970153914 4:13121463-13121485 AATGCAAAGTTAAACAAACCTGG + Intergenic
975777782 4:77807119-77807141 CATGCCCAGCTAACCAAGGCAGG - Intronic
977972874 4:103231399-103231421 GATACCAAGTTAAAGAAAGAAGG - Intergenic
980782847 4:137514169-137514191 GATGCACTGGTAAGCAAAGCAGG + Intergenic
981285586 4:143015420-143015442 GATGCACAGTTCAACATGGCTGG + Intergenic
985480597 5:107891-107913 GAAGCCCAGGTATACAAACCTGG - Intergenic
986270426 5:6225442-6225464 GATGCTAAGATAAACAAAACTGG - Intergenic
989515550 5:42338917-42338939 GATGCACAGTTCAGCATAGCTGG + Intergenic
990665324 5:58065662-58065684 GATGTCCCATTAGACAAAGCAGG - Intergenic
990994208 5:61714998-61715020 GATGCCGAGTTTAGCAAAGCTGG + Intronic
996528659 5:124503964-124503986 AATGGCCACTTAAACAAAACTGG + Intergenic
997907435 5:137832700-137832722 GAGGCCCAGTTAACCGGAGCTGG + Intergenic
998270062 5:140698403-140698425 GATGCAGAGTAAAACAAATCTGG + Intronic
999347627 5:150838535-150838557 GAGCCCCAGTTAAATAAGGCAGG - Intergenic
999783015 5:154866116-154866138 GATGCCCAGTTAAACAAAGCAGG - Intronic
1002889154 6:1318179-1318201 GTTGCACAGTTTCACAAAGCTGG + Intergenic
1005052900 6:21701741-21701763 GATGGCCATTTTAACACAGCTGG - Intergenic
1009633148 6:66226120-66226142 GCTGCCTAGATAAATAAAGCAGG + Intergenic
1012389465 6:98720873-98720895 CATGTCCAGTTAAACTAAGAAGG - Intergenic
1012478800 6:99645102-99645124 GACTCCCAGTTCCACAAAGCTGG + Intergenic
1014436322 6:121424856-121424878 GATTCACAGTTCAACAAGGCTGG + Intergenic
1015661229 6:135575818-135575840 GCTGACCAATTAAAAAAAGCTGG - Intergenic
1016904261 6:149133226-149133248 GTTTCTCAGATAAACAAAGCAGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019688133 7:2393804-2393826 GATGCCTCGTGAAACACAGCTGG - Intergenic
1021673880 7:23061072-23061094 GTTGCCCAGTTTTACACAGCTGG - Intergenic
1021841553 7:24725453-24725475 GATACCAAGTTAAACAAGGAAGG + Intronic
1022883190 7:34612271-34612293 AATGCCAAGTTCAACTAAGCAGG - Intergenic
1026806071 7:73430320-73430342 AATGCCCAGGTGATCAAAGCTGG + Intergenic
1031246285 7:119316926-119316948 GAAGCCCACTTAAGCAAAGTGGG - Intergenic
1034010197 7:147521360-147521382 GATGCCTAGTAGAAAAAAGCTGG + Intronic
1036018608 8:4816043-4816065 GGTGCACAGATAAACACAGCAGG + Intronic
1036220142 8:6914558-6914580 GCTGCCAAGAAAAACAAAGCTGG - Intergenic
1039823850 8:41156712-41156734 CATGCCCAGTTGAACCAAGCAGG + Intergenic
1048494836 8:134926309-134926331 AATGCCCAGTTAAGCCCAGCTGG - Intergenic
1048775685 8:137943650-137943672 GATGCACATATAATCAAAGCAGG + Intergenic
1050276728 9:4008478-4008500 GACCCCTAGGTAAACAAAGCAGG + Intronic
1050516319 9:6447606-6447628 GATTTCCAGTTAAACATGGCAGG + Intronic
1050773453 9:9233156-9233178 GACTCCCAGTTCCACAAAGCTGG + Intronic
1052221900 9:26034381-26034403 GATGCCCAATTTTACCAAGCTGG - Intergenic
1056574592 9:87845414-87845436 GTGTCCCAGTAAAACAAAGCAGG - Intergenic
1056764380 9:89435936-89435958 GCTGCCCAGTAAGAGAAAGCAGG + Intronic
1056846688 9:90044374-90044396 TATGCCAAGTGAAACAAACCAGG + Intergenic
1061786604 9:133032402-133032424 GAAGGGCAGTTAAACAGAGCGGG + Intronic
1185489156 X:507565-507587 CATTCCCAGTTAAACACAGAAGG - Intergenic
1186692204 X:11990182-11990204 GATGCTAAGTTAAACAAGCCAGG + Intergenic
1187169585 X:16838278-16838300 GATGCCAAGTAAAATAAGGCTGG - Intronic
1189071135 X:37865648-37865670 GATTCACAGTTCAACATAGCTGG + Intronic
1199448220 X:147951698-147951720 GATGCCCAGTTAGACAGAATGGG - Intergenic
1201234678 Y:11897628-11897650 GATGACATGTTAAACAAAGGTGG + Intergenic