ID: 999783555

View in Genome Browser
Species Human (GRCh38)
Location 5:154870716-154870738
Sequence TTTCAGAAGCATGAAGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 613}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999783550_999783555 17 Left 999783550 5:154870676-154870698 CCAGGATTCCATAGATCTCCTTG 0: 1
1: 0
2: 2
3: 6
4: 146
Right 999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 613
999783549_999783555 18 Left 999783549 5:154870675-154870697 CCCAGGATTCCATAGATCTCCTT 0: 1
1: 0
2: 0
3: 8
4: 156
Right 999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 613
999783551_999783555 9 Left 999783551 5:154870684-154870706 CCATAGATCTCCTTGCTAACTCA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 613
999783553_999783555 -1 Left 999783553 5:154870694-154870716 CCTTGCTAACTCAGGACTACAGT 0: 1
1: 0
2: 0
3: 3
4: 92
Right 999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999783555 Original CRISPR TTTCAGAAGCATGAAGAGGA AGG Exonic
900568943 1:3348936-3348958 TTTGAGAGGCATTAAGAGAAGGG + Intronic
901123460 1:6913112-6913134 GTTTACAAACATGAAGAGGAAGG - Intronic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
902125814 1:14210044-14210066 TTTCTGTAGCATGATGAGAAAGG + Intergenic
902702412 1:18181548-18181570 TGTCAGGAGCAGGAAGGGGAAGG - Intronic
903210181 1:21813824-21813846 TTTCAAAAGCAGGAAGAAAAGGG + Intronic
903290228 1:22307658-22307680 TTCCAGAAAACTGAAGAGGAGGG + Intergenic
903915697 1:26762795-26762817 TTCCAGAAGCATGTAAAGGCAGG - Intronic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
905126261 1:35718215-35718237 ATTGAAGAGCATGAAGAGGAAGG + Intronic
905434853 1:37949207-37949229 TTTCAGCTGCAAGAAGAGGTGGG + Intergenic
905839931 1:41167403-41167425 TTCCAGAAAGTTGAAGAGGAGGG - Intronic
906155918 1:43613825-43613847 TTTCAGGAGCACAGAGAGGAGGG + Intronic
906419403 1:45651604-45651626 TTTCAGCTGCATATAGAGGATGG + Intronic
906454956 1:45986912-45986934 TTCCAGAAAATTGAAGAGGAGGG - Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907529236 1:55076731-55076753 TCTCAGAAGTGTGAAGAGCAGGG - Intronic
907867303 1:58410537-58410559 TTTCACCAGCATGAATAGGCTGG + Intronic
908413263 1:63887294-63887316 TGTCTGAAGAAAGAAGAGGAGGG + Intronic
908641960 1:66234038-66234060 TTTTAGAAAATTGAAGAGGAGGG - Intronic
908701945 1:66911740-66911762 CTTCACAAGTATGAAGAGTAAGG - Intronic
908710497 1:67008902-67008924 TTTAAGAAGCAGGGAGAGGTTGG - Intronic
908798470 1:67854647-67854669 TATGAGAAGAATGGAGAGGAGGG + Intergenic
909666798 1:78143226-78143248 CTAAAGAAGCCTGAAGAGGAGGG - Intergenic
909908761 1:81234072-81234094 TTTCTGAAAAATGAAGAGAATGG + Intergenic
910215792 1:84843066-84843088 TTTAAGCAGCATGAAGACCAAGG - Intronic
910589655 1:88917022-88917044 TCTTATAAGCCTGAAGAGGATGG - Intergenic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
911008129 1:93248999-93249021 TTTCAAAAAATTGAAGAGGAGGG - Intronic
911108561 1:94158886-94158908 CTTAAGAAGCAAGAAGAGGCTGG - Intronic
911364697 1:96923028-96923050 TTCCAGAAGCAGGAAAAAGAGGG + Intergenic
912816480 1:112832823-112832845 TCCCAGAAGCAAGAGGAGGAAGG + Intergenic
913033698 1:114938632-114938654 TTCCAGAATATTGAAGAGGAGGG - Intronic
915816393 1:158971103-158971125 TTTTAGAAGCTTGAAGAGTCTGG - Intronic
916311404 1:163402628-163402650 CTTGAGATACATGAAGAGGAGGG + Intergenic
916951641 1:169786095-169786117 TTTCAGAAACACAAAGAGGGAGG + Intronic
917177388 1:172251759-172251781 TTTCAAAAGGTTGAATAGGATGG + Intronic
917254000 1:173095025-173095047 TTTCTGAAGGAAGGAGAGGAGGG + Intergenic
917405416 1:174701171-174701193 TTTCAAAAGCATGAACAGCAAGG - Intronic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
918664557 1:187133797-187133819 TTTCAGAAAATTGAAGAGGGGGG + Intergenic
918858890 1:189795860-189795882 TTTCAGAAACGTGAGAAGGAGGG - Intergenic
919178457 1:194050384-194050406 TTTCAGAAGAAAAAAGAGAAGGG + Intergenic
919307812 1:195866411-195866433 TTTCAGAAGCAAGAATATCAGGG - Intergenic
920004694 1:202824394-202824416 TATCAGCAGTATGAGGAGGAAGG + Intronic
920111947 1:203593018-203593040 ATCCAGAAGCTTGTAGAGGAAGG - Intergenic
920219519 1:204386530-204386552 TTTAAGAAACTTGAAGTGGAAGG - Intergenic
920703944 1:208238240-208238262 TTTCAGAGGGAAGAGGAGGAGGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921391904 1:214624309-214624331 TTTCAGACAACTGAAGAGGAAGG - Intronic
921450282 1:215297232-215297254 TTTCCATAGCATGAAGAAGATGG + Intergenic
921545197 1:216466155-216466177 TTTCAGAAGACTTAATAGGAAGG + Intergenic
921828420 1:219700168-219700190 TTTCAGCAGCGTGATGGGGATGG - Intronic
921977121 1:221215339-221215361 TCTCAGAAGCATGACTAGGTGGG - Intergenic
922178579 1:223216036-223216058 TTTCTGTAGCATGCAGAGAAGGG + Intergenic
922500201 1:226091648-226091670 TTTCAGAAGCATGAAAATATGGG + Intergenic
922843083 1:228660429-228660451 TTCCAAAAACTTGAAGAGGAGGG + Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923635674 1:235693463-235693485 TGTGAGAAGCATGAACAGTACGG - Exonic
923910805 1:238441688-238441710 TTTTGGAAGCAAGTAGAGGATGG + Intergenic
923920244 1:238555939-238555961 TGCCAGAAGAATGAAGAGGTGGG - Intergenic
924230774 1:241960023-241960045 TTTCTCAAGGATGAAGAGGAGGG - Intergenic
924301866 1:242647754-242647776 TTTCTGAAAAATGAAGATGAAGG + Intergenic
924944415 1:248836805-248836827 TCCCAGAGACATGAAGAGGATGG - Intergenic
1062871692 10:910107-910129 TTTCAGGAACATGAAGATAAGGG - Intronic
1063511664 10:6650372-6650394 GTTCAGAAGGATGATGAGAATGG - Intergenic
1065060309 10:21894268-21894290 TTTCAGAAAATAGAAGAGGAAGG + Intronic
1065163751 10:22952632-22952654 TTTCAGAAAATTGAAAAGGATGG + Intronic
1065735177 10:28745057-28745079 TTTCAGTAGGATGATGGGGAAGG + Intergenic
1066165271 10:32781264-32781286 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1067329741 10:45303954-45303976 TTACAGCAGCATGATGAGCAAGG - Exonic
1068444770 10:57107080-57107102 TGTTAGAAGCATGAAGAAGTGGG + Intergenic
1068601621 10:58963162-58963184 TTTCAACAGCATGACCAGGAGGG + Intergenic
1069019370 10:63468081-63468103 TTTCAGAGGACTGAAAAGGATGG - Intergenic
1069492793 10:68875596-68875618 TTCCATAAGCCTGAAGAAGAAGG - Intronic
1070269754 10:74941782-74941804 TTTCAGAAAATAGAAGAGGAGGG + Intronic
1070402937 10:76069237-76069259 TTTCACAAGCATGATGGGGAAGG + Intronic
1070715642 10:78719120-78719142 TTTCAGAGGCAGGAAGGAGATGG - Intergenic
1071100774 10:82035020-82035042 ATTCAGAACCATGAACAGCACGG - Intronic
1071124995 10:82323641-82323663 TTTCAGAATATTTAAGAGGAGGG - Intronic
1071667171 10:87570190-87570212 TTGCAAAGGCTTGAAGAGGAGGG + Intergenic
1071837473 10:89432992-89433014 TTTCAGAAACATGAAGAATCTGG + Exonic
1073190553 10:101647699-101647721 TTTCAGAAGAATGATAAGAAAGG + Intronic
1074669873 10:115778054-115778076 TTTGAGAATTATGGAGAGGAGGG + Intronic
1074932302 10:118141017-118141039 TTTCAGAACCTTGAAGAAGATGG - Intergenic
1076350708 10:129813170-129813192 TTTTAGGAGAATGAAGAGAATGG + Intergenic
1077821288 11:5744313-5744335 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1078044088 11:7897360-7897382 TTCCAGAAACATGAAGATAATGG + Intergenic
1079193542 11:18303195-18303217 TTTCGAAAACATGAAGAGGAGGG - Intronic
1080094344 11:28387650-28387672 TTTCAAAAAACTGAAGAGGAAGG + Intergenic
1082179096 11:49097301-49097323 TTTCAGAAGAAAGAAAGGGAAGG - Intergenic
1083040787 11:59684040-59684062 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
1083205826 11:61148452-61148474 ATTCAGCAGCATGATTAGGAAGG - Intronic
1084201393 11:67560875-67560897 TTCCAGGAGCATGAAGATAATGG - Intergenic
1084639450 11:70415882-70415904 ATCCAGAAACATGAAGAGGAGGG - Intronic
1085567066 11:77523712-77523734 TTTTAAAAGTATGAAGAGGCCGG - Intronic
1086456210 11:86961147-86961169 TTTGGGAAGCATGGAAAGGAAGG + Intergenic
1086467119 11:87066044-87066066 TTTCAGAGGCTTGAAGAGGGAGG + Intronic
1086614400 11:88798259-88798281 TTTCAGACAAATGAAGAGGATGG - Intronic
1086700347 11:89894714-89894736 TTTCAGAAGAAAAAAGGGGAGGG - Intergenic
1086705823 11:89949812-89949834 TTTCAGAAGAAAAAAGGGGAGGG + Intergenic
1087005462 11:93466674-93466696 TATCACTAGCATGAAGAGAAAGG - Intergenic
1087445570 11:98247537-98247559 TTTCAGAACATTAAAGAGGAGGG + Intergenic
1087665506 11:101042406-101042428 TTTAAGAAGCATGTAGAATAAGG - Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1088591716 11:111409055-111409077 TTTCAGAAGGAGGAAGAGATGGG + Intronic
1088961682 11:114673269-114673291 TTTCAGATGAATGAAAATGAAGG + Intergenic
1089473558 11:118740334-118740356 TTTCATGACCATGAAGAAGAGGG - Intergenic
1091144416 11:133265180-133265202 TTTCAGGAGGATGAAGCGGCAGG - Intronic
1091512927 12:1148426-1148448 TCTGTGAAGGATGAAGAGGAAGG - Intronic
1091717720 12:2791640-2791662 TTTAAGAAGTATGTAGAGGCCGG + Intergenic
1092393370 12:8101784-8101806 TTCCAGAAAATTGAAGAGGAGGG + Intergenic
1092798405 12:12137864-12137886 CTTTAAAAGCATGAAGAGGCTGG + Intronic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094132482 12:27089331-27089353 TTTCAGGGGCAGGGAGAGGATGG + Intergenic
1094377400 12:29804517-29804539 TTTCAGAAAATAGAAGAGGAAGG - Intergenic
1095262909 12:40118451-40118473 TTTCAGAAAATTGAAGAGTATGG + Intergenic
1096310334 12:50515121-50515143 TTTCAGAAGCTTAATGAGGCAGG - Intronic
1096365030 12:51021782-51021804 GTTAGGAAGCAAGAAGAGGAGGG + Intronic
1098086902 12:66855514-66855536 TTTCTAAAGCATAAAGAGAAAGG - Intergenic
1098743352 12:74202718-74202740 TTCCAGAATATTGAAGAGGAGGG - Intergenic
1099321547 12:81156959-81156981 TTTCAGAAAATAGAAGAGGAGGG + Intronic
1100262086 12:92941916-92941938 TTTCAGGAACATGAAGATAATGG + Intergenic
1100745622 12:97642446-97642468 TTTCAGATGGATGAAGAAGTTGG + Intergenic
1100747119 12:97658456-97658478 TTTTAGAAGGATGAAGATGGAGG - Intergenic
1101184253 12:102257065-102257087 TTTCAGAACATAGAAGAGGAGGG - Intergenic
1101400305 12:104381402-104381424 TTTCAGAAAATAGAAGAGGAGGG - Intergenic
1101627610 12:106461019-106461041 TTTCAGGAGAATGAGGAGGTAGG - Intronic
1102167991 12:110821209-110821231 TTTGAGAAGAAAGAAGAGGCTGG - Intergenic
1102474617 12:113180638-113180660 TTTCAGAAGGAGGGAAAGGATGG - Intronic
1102557158 12:113734637-113734659 TGTCAGAAGCTTCAAAAGGAGGG - Intergenic
1103898688 12:124291902-124291924 CTTCAGAAGCTTGTGGAGGAAGG + Intronic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104894810 12:132158917-132158939 AGTCAGAGGCGTGAAGAGGAGGG + Intergenic
1104993337 12:132639282-132639304 TTTCAGGATCCTGAAGAGCATGG - Exonic
1105516035 13:21091544-21091566 TTTCAGAAGCATGTAAAGATTGG - Intergenic
1106125957 13:26900192-26900214 TTCCAGAAACATGTAGGGGATGG - Intergenic
1106387865 13:29305743-29305765 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1107532835 13:41300831-41300853 TTTCAGGAACATGAAGATAATGG + Intergenic
1107829572 13:44362422-44362444 GTTCAGGAGGAGGAAGAGGAAGG - Intergenic
1108196796 13:48002948-48002970 TTCCAGAAGATAGAAGAGGAAGG + Intergenic
1108308657 13:49164121-49164143 TTTCATAACTTTGAAGAGGAAGG - Intronic
1108406025 13:50102967-50102989 TTCCAGAAAACTGAAGAGGAAGG + Intronic
1108910764 13:55548847-55548869 ATTCAGAAGCATGAAGATAATGG + Intergenic
1110143479 13:72160101-72160123 TATCAGCAGCAGGAAGAAGAAGG - Intergenic
1110265649 13:73534547-73534569 TTCCAGAAACATTAAGAAGATGG - Intergenic
1111539032 13:89647371-89647393 TTTCCAAAACTTGAAGAGGAAGG + Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1111855726 13:93634671-93634693 TTCTAGAAGCATGAAGGAGAGGG + Intronic
1112689327 13:101871998-101872020 TTTCAGATGAATTAAGAAGAGGG - Intronic
1112834020 13:103491504-103491526 TTTCAGAAGCATGCACAACATGG - Intergenic
1113664582 13:112132309-112132331 TTGTGGAAGCATGAAGTGGAGGG + Intergenic
1114372327 14:22103553-22103575 GTTCAGAAGCATGAGGACTAGGG - Intergenic
1114834916 14:26192567-26192589 TGGCAGAAACATGAAGAGTATGG + Intergenic
1115275408 14:31602980-31603002 TATCAGAAGCTTTAAGAAGAAGG + Intronic
1116207369 14:41885214-41885236 ACTCAGAAGGCTGAAGAGGAAGG + Intronic
1116907659 14:50420704-50420726 TTTCACTAACAGGAAGAGGATGG + Intronic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117639213 14:57779539-57779561 TTCCAAAAACCTGAAGAGGAAGG + Intronic
1117654439 14:57940010-57940032 TTTCAGTAGAATGATGGGGATGG + Intronic
1118412189 14:65492704-65492726 TTTCAGGAGAAGGAAGAGAAAGG + Intronic
1118449257 14:65883602-65883624 TTCCAGAAAATTGAAGAGGAGGG - Intergenic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1120500196 14:85287814-85287836 TTTAGGAAGCATTAAGAGTAAGG + Intergenic
1120542692 14:85769807-85769829 TTACAGGAGCAGGCAGAGGATGG + Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1120837175 14:89050905-89050927 TTTCAGAAGGAAGAAGCAGAGGG + Intergenic
1121425608 14:93849428-93849450 CTCCAGAAGCTTCAAGAGGAAGG - Intergenic
1121586652 14:95067574-95067596 TTCCAGCAGCATGAGGGGGAGGG + Intergenic
1121774028 14:96578414-96578436 TTCAAGAAGGATGAAGGGGAGGG + Intergenic
1121927759 14:97944512-97944534 TTTCAGCCTCATGCAGAGGATGG + Intronic
1122120160 14:99548850-99548872 TCTCAAAAACATGAAGAGGATGG + Intronic
1122184994 14:99985418-99985440 TTTCAGATGCTTGAAGACAATGG + Intronic
1122653684 14:103242321-103242343 TTTCAGAAACATGAAGATAATGG + Intergenic
1122655162 14:103253860-103253882 TTCCAGGAGCATGAAGATAATGG + Intergenic
1122823449 14:104358599-104358621 TTTCAGGAGCATGAGGAGGTGGG + Intergenic
1122852086 14:104540123-104540145 TTTCAGAAAACTGAAGAGGAGGG - Intronic
1123993932 15:25705074-25705096 TTTCAAGAGCATGGAGAGAACGG + Intronic
1124531126 15:30507614-30507636 GAACAGGAGCATGAAGAGGATGG + Intergenic
1124767529 15:32500082-32500104 GAACAGGAGCATGAAGAGGATGG - Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126890858 15:53202816-53202838 TCTCAGTAGAATGATGAGGAAGG - Intergenic
1127300877 15:57652288-57652310 TTTAATAAGCATGAAGAAAATGG - Intronic
1127403377 15:58614495-58614517 TTTCACAGGCATGGAGAGAATGG + Intronic
1127650958 15:61006613-61006635 TTTCAGAGGCTGGCAGAGGAAGG - Intronic
1128118111 15:65125158-65125180 TTACACAAGCATGAAAATGAAGG - Intronic
1128926432 15:71660471-71660493 TATCAGGAGCATGCAGAGGAAGG - Intronic
1129105361 15:73303564-73303586 TTCCAGAAGCCTGCAGAGAATGG + Exonic
1129184178 15:73895756-73895778 TGTCAGAAGCATCCTGAGGAAGG + Intergenic
1130806089 15:87324668-87324690 ATTCAGGAGAACGAAGAGGAAGG + Intergenic
1130841257 15:87703311-87703333 TTTCATGATCCTGAAGAGGAAGG - Intergenic
1131141756 15:89982105-89982127 TTTCAGGAACATGAAGATAATGG - Intergenic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1134192890 16:12136172-12136194 GCTCAGAAGCATGAAGAGAATGG - Intronic
1134543657 16:15090488-15090510 TTTTAGAAGGCTGAAGAGAAAGG + Intronic
1135361237 16:21816638-21816660 TTTTAGAAGGCTGAAGAGAAAGG + Intergenic
1135838710 16:25853890-25853912 TTTCAAGAACTTGAAGAGGAGGG - Intronic
1136261293 16:29078760-29078782 TTTTAGAAGGCTGAAGAGAAAGG - Intergenic
1136265286 16:29113442-29113464 TGGCAGCAACATGAAGAGGAAGG - Intergenic
1136643192 16:31585581-31585603 TTCCAAAAACATGAAAAGGACGG - Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137391719 16:48086889-48086911 TTTCTGTAGCATGTGGAGGAGGG + Intronic
1137659672 16:50193755-50193777 TTCCTGAAGGATGAGGAGGAGGG + Intronic
1137997535 16:53235000-53235022 TTCCAGAAAACTGAAGAGGAAGG - Intronic
1138197730 16:55064861-55064883 TTCCAGAAAATTGAAGAGGAGGG + Intergenic
1138319355 16:56098631-56098653 TTTCTGAACCATGGAGAGGATGG + Intergenic
1138402896 16:56762795-56762817 AATCAGAAGCCAGAAGAGGAAGG - Intronic
1138868744 16:60854062-60854084 CTTCAGAATGATGAAGACGATGG - Intergenic
1138980660 16:62264102-62264124 TATCAGAAATAAGAAGAGGAAGG - Intergenic
1139808652 16:69592681-69592703 TTTCAGAAGCATGAATTGAGGGG - Intronic
1140159905 16:72478718-72478740 TTTCAGAAAGCAGAAGAGGAGGG + Intergenic
1140642120 16:76987230-76987252 TTTTAGAATCTTGGAGAGGAAGG - Intergenic
1141661386 16:85443445-85443467 TCTCAGTAACATGAGGAGGAAGG - Intergenic
1141716455 16:85729806-85729828 TATCAGAAGCTGGAAGAGGCAGG + Intronic
1142171499 16:88624929-88624951 TTTCTGGAGCGTGAAGGGGAAGG + Intronic
1142552199 17:747692-747714 TTTGAGCAGCTCGAAGAGGATGG + Exonic
1143705603 17:8695980-8696002 AATCAGAAGCATGAATAGCAGGG + Intergenic
1143709445 17:8724227-8724249 CTTCTGAAGAAAGAAGAGGAGGG - Intergenic
1144177520 17:12721366-12721388 TTTCAGAGGCAACAAGATGAAGG + Intronic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1145870635 17:28270389-28270411 TTTCAGGAGAATGCAGAGGTGGG + Intergenic
1146108674 17:30067116-30067138 TTTTAGAAAATTGAAGAGGAGGG + Intronic
1146418596 17:32661265-32661287 GTTTAGAAGGATGAAGAGAAGGG - Intronic
1146543080 17:33714595-33714617 TTTAAAAACCATGAACAGGAAGG + Intronic
1146606937 17:34268610-34268632 TTTTAGAAGCATCAGGTGGATGG + Intergenic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1147922149 17:43924274-43924296 TTTCAGGAGAATGCAGAGGTGGG + Intergenic
1149282215 17:55119826-55119848 TATCAGAAGCATGAAAGGAAAGG - Intronic
1150122507 17:62615966-62615988 TTTCTGAAGCTTGCAGAGGTGGG - Intergenic
1151544444 17:74784021-74784043 TTTTTAAAGCATGAAGAGGACGG - Intronic
1152341696 17:79729263-79729285 GCACAGAAGCATGAAGAAGAGGG + Intergenic
1152908167 17:82981513-82981535 TTCCAGGAGCATGAAGATAATGG - Intronic
1153603220 18:6803613-6803635 TTTCAGAAAATTGAAGGGGAGGG - Intronic
1154344383 18:13530250-13530272 TTTTAAAAGTAAGAAGAGGAAGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155535723 18:26815221-26815243 TTTCAAAAGATTGAAGAGGACGG - Intergenic
1156033337 18:32738903-32738925 TCACAGAAGAATTAAGAGGAAGG - Intronic
1156360672 18:36381939-36381961 TTTCAGGAGCATGTCAAGGAAGG + Intronic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1156766223 18:40659884-40659906 TTTCAGAATTATGAAGGGAAGGG - Intergenic
1157725127 18:49958389-49958411 GGTCAGAAGCTTGAAGAGAATGG - Intronic
1158063021 18:53369993-53370015 TTTCAAAAAACTGAAGAGGAGGG - Intronic
1159397412 18:67879957-67879979 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1159638271 18:70832685-70832707 TTCCAGAATAATGAAGAGGAGGG - Intergenic
1159799588 18:72880895-72880917 TTTCAAAAACATGGATAGGACGG - Intergenic
1159847201 18:73477141-73477163 TATCAGCAGCATGAAAACGACGG - Intergenic
1159877436 18:73828062-73828084 TTTCATATTCACGAAGAGGAAGG + Intergenic
1160042325 18:75357133-75357155 TGGCAGAAGGATGAAGGGGAAGG - Intergenic
1160434921 18:78842712-78842734 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1161081920 19:2315511-2315533 TTTCAGAAACTAGAGGAGGAAGG - Intronic
1161223285 19:3129093-3129115 TTTCAGAAAATAGAAGAGGATGG + Intergenic
1161601792 19:5188700-5188722 ATTCAAAAGGATGAATAGGAAGG - Intronic
1161747030 19:6066964-6066986 TTTCAGAAGCCCTAAGAGAAAGG + Intronic
1162598715 19:11650127-11650149 ATTGAGTAGCCTGAAGAGGAGGG + Intergenic
1162876549 19:13624904-13624926 TATAAGAAGCATCAAGAGGCCGG + Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163648320 19:18502787-18502809 TCTCAGAAGCAAAAACAGGAAGG - Intronic
1164768883 19:30792762-30792784 GTTCAGAAGCAGTAAGAGCATGG - Intergenic
1165122690 19:33571196-33571218 TTACAGAAGAAGGAAGAGAAAGG + Intergenic
1165569332 19:36762147-36762169 GTTCTGAAGCATGGAGAAGATGG + Intronic
1165647099 19:37450183-37450205 TTTCAGAATATTGAGGAGGAGGG - Intronic
1166582256 19:43912107-43912129 TCTCAGAAGCATTAAGTGAAAGG + Intergenic
1167222295 19:48208222-48208244 GATCACAATCATGAAGAGGATGG + Exonic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
1168551219 19:57296784-57296806 TCCCAGAATAATGAAGAGGAGGG - Intergenic
925112485 2:1347860-1347882 TTCCAGGAACATGAAGATGATGG - Intronic
925197263 2:1936217-1936239 TTTAAGATGCAGGTAGAGGACGG - Intronic
925877623 2:8326453-8326475 TTTCAGCATCATGGAGTGGAAGG + Intergenic
926000937 2:9331915-9331937 CTGCAGAAGCTTGCAGAGGAGGG + Intronic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926334517 2:11853284-11853306 AGTCAGAAGCATGAAGAATAGGG - Intergenic
926339555 2:11893909-11893931 TTTCAGAAACTTGGATAGGAGGG + Intergenic
926410565 2:12597897-12597919 TTCCAGAAGAAAGAAGAGGCAGG - Intergenic
926464748 2:13174606-13174628 TTTCAGAAAATAGAAGAGGAGGG - Intergenic
927074826 2:19567215-19567237 TTTCAGAAGCCTTAAAAGAAAGG + Intergenic
927684666 2:25161977-25161999 AGGCAGAAGCATGAAGGGGATGG - Intronic
928484349 2:31714404-31714426 TTTCACAAAAAGGAAGAGGAAGG + Intergenic
928840059 2:35595283-35595305 CTTCAGATACATGAAGAAGAAGG - Intergenic
929180858 2:39037220-39037242 TTTCAAAAACAACAAGAGGATGG + Intronic
929371616 2:41231242-41231264 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
929575399 2:43048824-43048846 TTTCATAAGGAAGTAGAGGAAGG - Intergenic
929610783 2:43269278-43269300 TTTCAGAAGCAGCAAGAGTCAGG + Intronic
929842041 2:45477176-45477198 TTTTAGAGGGATGATGAGGAGGG - Intronic
929846269 2:45531970-45531992 TATCAGAAGATTGAAGAGGGTGG - Intronic
930215608 2:48693278-48693300 TTTCAGAACCATGAGAATGAAGG - Intronic
930230881 2:48842728-48842750 TGTCAGTAGAATGAAGGGGATGG + Intergenic
930380088 2:50617065-50617087 TTTCAGAAGTAACAAGAGCAGGG + Intronic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931243559 2:60474414-60474436 TTTCAAAAGGTTGAATAGGATGG + Intronic
931250289 2:60524784-60524806 TTTCAGAAGCATGCTGAAAAAGG - Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932963624 2:76444506-76444528 TTTTAGAACCAAGAAGAGCATGG + Intergenic
933248101 2:79998267-79998289 ATTCAGAAGCATGGATAGTAGGG + Intronic
933763175 2:85688326-85688348 TTTCAGATCAATGGAGAGGAGGG + Intronic
933870342 2:86559798-86559820 ATTCATAGGCAGGAAGAGGATGG + Intronic
934653527 2:96105483-96105505 TCTCAGAAGCATGGAAAGCAAGG - Intergenic
935067007 2:99658115-99658137 AGTCAGAAGCAAGAAGAGAAAGG + Intronic
935475690 2:103519424-103519446 TTCCAGAATATTGAAGAGGAGGG - Intergenic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
936535505 2:113307995-113308017 GTTCAGAAACAGGCAGAGGAGGG - Intergenic
937467600 2:122148387-122148409 TTACTGAAGCATGAGGGGGAGGG + Intergenic
937673254 2:124561229-124561251 TTTCAGAAGCAGGGAGATGCTGG + Intronic
938325598 2:130397387-130397409 TTTCAAAACAATGAAAAGGAGGG + Intergenic
938423358 2:131162814-131162836 TTTCAAAACAATGAAAAGGAGGG - Intronic
939108144 2:137973805-137973827 TTTCAGAAACATGAGCAGGGAGG + Intronic
939554086 2:143653397-143653419 TTTCACAAAATTGAAGAGGATGG - Intronic
939705196 2:145444182-145444204 AATCAAGAGCATGAAGAGGAAGG + Intergenic
940151600 2:150608445-150608467 CTTCACAAGCATGAAGAGTAAGG + Intergenic
940463890 2:154003816-154003838 TCACAGAAGGAGGAAGAGGAGGG - Intronic
940466061 2:154028461-154028483 TTTAAGTAGAAAGAAGAGGATGG - Intronic
941342363 2:164323159-164323181 TTTTAGAAGGCTGAGGAGGAAGG - Intergenic
942538647 2:176992337-176992359 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
942728479 2:179036869-179036891 ATTCAGAATCTTGAAGAGAAAGG - Intronic
943352227 2:186809108-186809130 TATAAGAAGCATAAAGAAGAGGG + Intergenic
943593903 2:189832202-189832224 CTTAAGAATCATGTAGAGGATGG + Intronic
944130830 2:196346062-196346084 TTTCTGAGGCCTCAAGAGGAAGG - Intronic
944516244 2:200514600-200514622 TATCAGAAGTATGAGGATGAGGG + Intronic
945031589 2:205669450-205669472 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
946578165 2:221099077-221099099 TTTTATAAGCATGAAGACAATGG + Intergenic
946811683 2:223531937-223531959 TTACAGAAGCGTGAAGAAGAGGG - Intergenic
946963538 2:225010893-225010915 ATTTAGAACCATGAAGATGATGG - Intronic
947238055 2:227964528-227964550 TTTCAGGAACATGAAGATAATGG + Intergenic
947485826 2:230547975-230547997 TTTCACAAACCTGAAGAGGTAGG - Intergenic
947923783 2:233903178-233903200 TCTCTGCAGCATGAAAAGGACGG + Intergenic
947968242 2:234300378-234300400 TTTTAGAAACATGAAGGTGAGGG + Intergenic
948713727 2:239844336-239844358 TTCCAGAAAACTGAAGAGGAGGG - Intergenic
1168730745 20:78287-78309 TTACAGAAAATTGAAGAGGAGGG + Intergenic
1168843065 20:922100-922122 TTTCAGAAGAAGGTATAGGATGG + Intergenic
1169607666 20:7340541-7340563 TTCCAGAAAAGTGAAGAGGAAGG + Intergenic
1169934912 20:10873037-10873059 TGACTGAAGCATGAAGATGAAGG - Intergenic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1170125977 20:12964807-12964829 TTTAAGGAGCATGAAGGGTAGGG + Intergenic
1170636645 20:18111466-18111488 TTTCAGAAGCTAGAAGCTGAGGG - Intergenic
1170780842 20:19423987-19424009 GTTATGAAGCATGAAAAGGAAGG + Intronic
1171108412 20:22458082-22458104 TTTGAGAATCATGCAGAGAAAGG - Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1171725326 20:28613668-28613690 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171789527 20:29508156-29508178 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171858007 20:30366292-30366314 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1173270871 20:41533601-41533623 TGTCTGAAGCATGAATTGGAAGG - Intronic
1173813183 20:45968651-45968673 TTTGAGAAGTTTGGAGAGGAAGG - Intronic
1173994635 20:47328283-47328305 TTTTATAAGCATGGAGAGGGTGG + Intronic
1176906954 21:14512560-14512582 TTTCTGAAGGATGAGGAAGATGG - Exonic
1177022676 21:15882931-15882953 TTTCAAAAGATTGAAAAGGAGGG - Intergenic
1177167126 21:17614974-17614996 TTTCAGTCCCATAAAGAGGAGGG - Intergenic
1177319690 21:19504953-19504975 TTCCAGAAATTTGAAGAGGAGGG - Intergenic
1178031546 21:28532822-28532844 TTTCAGAAGATTGAAGCAGAGGG - Intergenic
1178046534 21:28700749-28700771 TTTCAGAAAATTGAGGAGGAGGG + Intergenic
1179068848 21:38053048-38053070 TTTCAGAGGAAGGAAGGGGATGG + Intronic
1179281688 21:39939242-39939264 TTTCAGAAGAGTGGAGGGGAGGG + Intergenic
1180116539 21:45709615-45709637 TTACAGAATTATGATGAGGATGG + Intronic
1180206159 21:46262260-46262282 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1181529977 22:23511856-23511878 TTCCAGCAGCATGGGGAGGAAGG + Intergenic
1182574363 22:31262856-31262878 TTTCAGAAGCCTGCAGAGTTAGG + Intronic
949562764 3:5218047-5218069 TTCCAGGAGCATGAGGAGGAAGG - Exonic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950703053 3:14763200-14763222 TTTCAGAAACATTCAGAAGAAGG + Intronic
950778671 3:15372737-15372759 TTTCAATAGCATGAACAGGTGGG - Intergenic
951213037 3:19996538-19996560 TTTCAGAAAATTGAAGAGGAAGG + Intronic
951868759 3:27336451-27336473 TTCCAGAAAATTGAAGAGGAAGG + Intronic
952134451 3:30400968-30400990 GGGCAGAAGCATGGAGAGGATGG - Intergenic
952676581 3:36038056-36038078 TTCCAGAAAAATAAAGAGGAAGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952872395 3:37912348-37912370 TTTCAAAAGCAGCAAGAGGCTGG - Intronic
953224607 3:41006166-41006188 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
953349817 3:42207018-42207040 CTTCAGAAGGATGAGGAGGTTGG + Intronic
954261712 3:49443840-49443862 TTCCAGGAGCATGAAGATAATGG + Intergenic
954475398 3:50739675-50739697 TTTCAGAAGTATAAAGAGAATGG + Intronic
954485682 3:50849141-50849163 TCTCAGAAGCCTAAAGTGGAGGG - Intronic
954668259 3:52272169-52272191 TTACAGAACCTTGAAGAGCAAGG + Intronic
954853875 3:53626221-53626243 GGTCAGAGGGATGAAGAGGAGGG + Intronic
956385195 3:68709811-68709833 TTCCAGAAAATTGAAGAGGAGGG - Intergenic
957037320 3:75306484-75306506 TTCCAGAAAAGTGAAGAGGAGGG - Intergenic
957564091 3:81862964-81862986 TTTCAGGAACATGAAGATAATGG + Intergenic
957780046 3:84807285-84807307 TCTCAGAAACTTGAAGTGGAAGG - Intergenic
958130086 3:89407599-89407621 TGTCAGAAGAGAGAAGAGGAGGG - Intronic
958613066 3:96452447-96452469 TATCAGAACCCTGAAAAGGAAGG + Intergenic
958932948 3:100226988-100227010 TTGCAGAGGCATTAAGAAGAAGG + Intergenic
958940390 3:100306236-100306258 TTTTAGAAGGAAGAATAGGAAGG + Intronic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959329497 3:104985342-104985364 TTTCAGCAAAATGAAGAGTAAGG - Intergenic
959547988 3:107620538-107620560 CTTTAGCAGCATGAAGAGGATGG + Intronic
959881740 3:111451291-111451313 TTTCAAAAACTTGAGGAGGAGGG + Intronic
959977910 3:112482795-112482817 TTTCAAAAAAATGAAGAGAAAGG + Intronic
959998748 3:112708022-112708044 TTTCAGAAAGTTGAGGAGGAGGG - Intergenic
961170332 3:124793300-124793322 TTTCAGGATCCTGAAGGGGAAGG + Intronic
961346733 3:126268120-126268142 ATGCAGGAGGATGAAGAGGACGG - Intergenic
962496143 3:135941155-135941177 TTCCAGAAAATTGAAGAGGAAGG - Intergenic
962945229 3:140162758-140162780 TTTCTGAAGCATGGAGAAGCAGG + Intronic
962972286 3:140413505-140413527 TTTCAAAACACTGAAGAGGAGGG + Intronic
963301509 3:143602283-143602305 TGTCAGGAGCATGCACAGGAAGG - Intronic
963877171 3:150489364-150489386 TTCCAGGAACATGAAGATGACGG - Intergenic
963879213 3:150509413-150509435 TTCCAGAAAATTGAAGAGGAAGG + Intergenic
965123478 3:164594178-164594200 TTTCAGCTGCAGGAAGAGGGAGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965325335 3:167295886-167295908 TTCCAAAAGATTGAAGAGGAGGG + Intronic
965786246 3:172338353-172338375 TATCAGAGGCAGGAAGGGGAAGG + Intronic
965956081 3:174371452-174371474 GTTCAAAAAAATGAAGAGGAAGG + Intergenic
966144401 3:176793514-176793536 TAACAGAAACATGAAGAGTAAGG + Intergenic
966819083 3:183910880-183910902 TTTCAGGAGCAGGAAGGAGATGG + Intergenic
967039755 3:185680410-185680432 TTCCAAAAAAATGAAGAGGAGGG + Intronic
971573365 4:28242880-28242902 TTTCAGAAAATTGAAGATGAGGG - Intergenic
972214896 4:36885926-36885948 TTTCAGTAACATGGATAGGAAGG - Intergenic
973230545 4:47835800-47835822 TTTCTGCAGCATTATGAGGAAGG + Intronic
974257641 4:59481599-59481621 TTTCAGAAATCTGAAGAGAAGGG + Intergenic
974452125 4:62078467-62078489 TTTCCAATGCATGAAGGGGAGGG - Intergenic
974501890 4:62715636-62715658 TTTCAAAAAATTGAAGAGGACGG - Intergenic
974642910 4:64654863-64654885 TTTCAGAAGCAGGAAGACAATGG - Intergenic
975288490 4:72648539-72648561 ATTCAGACTGATGAAGAGGAAGG + Intergenic
976207930 4:82639892-82639914 TTTCAGAAGCAAGATGGGGGTGG - Intronic
976306155 4:83561444-83561466 TTGCAGAGGCAAGAAGAAGAAGG - Intronic
977069637 4:92368293-92368315 CTTGAGAAGCATTAAGAGGTAGG + Intronic
978176563 4:105739393-105739415 TTCCAGAAAATTGAAGAGGAGGG - Intronic
978473634 4:109099995-109100017 TTACAGAAGGATTGAGAGGAGGG - Intronic
979110587 4:116750112-116750134 TTTCAGAAAGTAGAAGAGGAGGG + Intergenic
980439763 4:132826081-132826103 TTTCAGAAAATTGAAGAGGAGGG - Intergenic
980622765 4:135330588-135330610 TTCCAGAATCTAGAAGAGGAAGG - Intergenic
980720239 4:136686301-136686323 TATGAGCAGCATGAAGAGGCGGG - Intergenic
980815219 4:137938540-137938562 TTTCAAAAAAGTGAAGAGGAAGG + Intergenic
980907292 4:138961028-138961050 ATTCAGAAACAAGAGGAGGAGGG - Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981235638 4:142412082-142412104 TTTCTGAAGTACAAAGAGGAAGG - Intronic
982356886 4:154480541-154480563 TTTCAAAAGCATGAAGGAGATGG + Intronic
982526274 4:156483239-156483261 TTTTAAAATCAAGAAGAGGAAGG - Intergenic
982842677 4:160211586-160211608 TTTCACAGACATCAAGAGGAGGG + Intergenic
982879275 4:160690588-160690610 TTTCAAAAAATTGAAGAGGAAGG + Intergenic
983467760 4:168116020-168116042 TTTGAAAAGCAAGAAAAGGAAGG + Intronic
983473842 4:168190767-168190789 TTCCAAAAGACTGAAGAGGAGGG + Intergenic
983876766 4:172886078-172886100 TTTCAAAAAATTGAAGAGGAGGG - Intronic
984358306 4:178693756-178693778 TTTCTGAAGCATGAAGGCAAAGG - Intergenic
985435253 4:189924103-189924125 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
986143978 5:5059590-5059612 TTTCAGATTCTTGAAGATGAAGG - Intergenic
986263194 5:6167075-6167097 GTTCACATGCATGAAGAGTATGG - Intergenic
986598735 5:9450016-9450038 TTTTATGAGCATGAACAGGATGG - Intronic
986832208 5:11592330-11592352 TTTTAGAAAAAAGAAGAGGAAGG - Intronic
987022259 5:13886795-13886817 TTTCAGGATCATGCAGAGCAAGG - Intronic
987844017 5:23258151-23258173 TTTCAGGAACATGAAGATAATGG - Intergenic
988371947 5:30381576-30381598 TTTCAGAAAAATGAAGAAAATGG + Intergenic
988775681 5:34476234-34476256 TTTCAGAAACATAAAGACAATGG + Intergenic
989119820 5:37993233-37993255 TTTGATAAGCATGAAGATGGAGG - Intergenic
990215299 5:53524921-53524943 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
990272844 5:54163457-54163479 TTCCAGAAAATTGAAGAGGAGGG - Intronic
990445107 5:55886907-55886929 TGACAGAAGCATGCAGAGGAGGG - Intronic
990976505 5:61565836-61565858 GTTCAGGAGCATGAAGAGGCTGG - Intergenic
990992213 5:61697440-61697462 ATCCAGAAGCAAGGAGAGGAAGG - Intronic
991041635 5:62182421-62182443 CTTCAGAGGCATGCAGAGGCTGG - Intergenic
991394369 5:66188395-66188417 CTTCAGAAAAGTGAAGAGGAGGG - Intergenic
991653678 5:68882108-68882130 TTTGAGGAGCATGGAGTGGAGGG - Intergenic
991920564 5:71652708-71652730 ATTAAGAAGTTTGAAGAGGAAGG + Exonic
992649782 5:78847599-78847621 TTCCAGAAAATTGAAGAGGAGGG - Intronic
992750640 5:79857557-79857579 TGGCAGAAGAATGGAGAGGAGGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993303713 5:86248542-86248564 TTTCAGGAAATTGAAGAGGAGGG - Intergenic
993941718 5:94066791-94066813 TTCCAAAAAAATGAAGAGGAGGG + Intronic
994516468 5:100778556-100778578 TTTCAGATAAATGAAGAGAAAGG - Intergenic
994797683 5:104325936-104325958 TTTTAGAAGCTGGAAAAGGATGG - Intergenic
995387422 5:111603216-111603238 TTGCAGAAGCCTGAAGAGTCAGG + Intergenic
995455858 5:112351570-112351592 TTTCAAAAACCTGAAGAGGAGGG + Intronic
995479959 5:112583738-112583760 TTTTAGAAGTATGAAGAGTAGGG - Intergenic
995637405 5:114209315-114209337 TTTAAGGAGCAAGCAGAGGAAGG - Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
995844468 5:116479185-116479207 TTTCTGAAGGATGAGGAGGTAGG + Intronic
996230771 5:121060879-121060901 CTTCAGAAGCATGTGGAGCATGG + Intergenic
997045170 5:130307397-130307419 TTCCAGAAAATTGAAGAGGAGGG - Intergenic
997154148 5:131533950-131533972 TAGCAGAAGCATGAAGAACAAGG - Intronic
997183916 5:131861985-131862007 TTTCAAAAAGTTGAAGAGGAGGG - Intronic
997362467 5:133303806-133303828 TTTCAGAAGCATGCCAAGGTGGG + Intronic
997950017 5:138235015-138235037 TTTGAGAAGGATGGAGTGGAGGG - Intergenic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998713907 5:144858993-144859015 TATCAGAAGAATAAAGAGGTTGG - Intergenic
999109154 5:149102280-149102302 TTCCAAAAACTTGAAGAGGACGG + Intergenic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000142117 5:158415518-158415540 TTTCAGAGGCTTGAGGAAGATGG + Intergenic
1000479532 5:161754611-161754633 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
1000533766 5:162455942-162455964 TTACATAAGCATGAAAAGTAAGG - Intergenic
1001132793 5:169078617-169078639 TCTTAGAAGGATGAAGATGAAGG - Intronic
1001513213 5:172337918-172337940 TTTTAGAAACATGAAGAAGTTGG + Exonic
1001852539 5:174981909-174981931 CTTCAGAAGACTGAAAAGGAGGG + Intergenic
1002123805 5:177026305-177026327 CTTCAGAAACAAGATGAGGAAGG - Intronic
1002315973 5:178343525-178343547 AATCAGAGGAATGAAGAGGAAGG + Intronic
1002367856 5:178727219-178727241 CTTCAGAAGCTTGAATAGTATGG - Intronic
1002714138 5:181215174-181215196 TTTTAGAAACATGGAGTGGATGG - Intergenic
1003200618 6:3956870-3956892 TTTTAGAACAATGAAGAGTAGGG - Intergenic
1003319686 6:5039423-5039445 TTTTAGAACAATGAAGAGCAGGG + Intergenic
1003382340 6:5636687-5636709 TTTCAGAAGCCAGCAGACGAAGG - Intronic
1003526263 6:6900120-6900142 TCACAGAAGAATTAAGAGGAAGG - Intergenic
1003795513 6:9598288-9598310 TTTCAGCTAAATGAAGAGGAGGG + Intronic
1004017404 6:11744636-11744658 TTACAGATTGATGAAGAGGAGGG - Intronic
1004188000 6:13438287-13438309 TTACATAAGAATGAAGAGAAAGG + Intronic
1004544388 6:16583416-16583438 CTACAGATGCATGAAGGGGAAGG - Intronic
1004984808 6:21069674-21069696 TTCCAGAAAAATGTAGAGGAAGG - Intronic
1005209024 6:23439449-23439471 TTTCAGAAAACAGAAGAGGAGGG - Intergenic
1006212331 6:32407058-32407080 TGTCAGCAGGATGAATAGGAAGG + Exonic
1006428845 6:33982848-33982870 ACTCAGCAGCATGCAGAGGATGG + Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007794081 6:44333506-44333528 CTGCAGAAGACTGAAGAGGAAGG + Intronic
1008123978 6:47648293-47648315 TTTCAGAAGTAGGAAGTCGAGGG - Intergenic
1008683703 6:53901429-53901451 ACTCAGAAGCCTGAAGGGGAAGG + Intronic
1009354133 6:62719567-62719589 TTTGGGAAACATGAAAAGGAAGG - Intergenic
1009439023 6:63654154-63654176 TTCCAGAAAATTGAAGAGGAGGG - Intronic
1009727779 6:67557703-67557725 TTCCAGAAGAAGGAACAGGAAGG - Intergenic
1010008159 6:71018682-71018704 TTCCAGAAAAGTGAAGAGGAGGG + Intergenic
1011250675 6:85368744-85368766 ATTTAGAAGAATGCAGAGGAAGG - Intergenic
1012077333 6:94707029-94707051 TTTCAGGAGAATGATGAGGGTGG + Intergenic
1012486869 6:99731631-99731653 TTTCAGAAAATTGAAGAGGAAGG - Intergenic
1013340462 6:109209958-109209980 TTCCAAAAACATGAAAAGGAGGG - Intergenic
1013939104 6:115639237-115639259 CTTCAGAAAATTGAAGAGGAAGG + Intergenic
1014562802 6:122911690-122911712 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
1014844328 6:126257538-126257560 TTCCAGAAAATTGAAGAGGAAGG - Intergenic
1015049486 6:128822168-128822190 TTCCAGAAAACTGAAGAGGAAGG + Intergenic
1015685763 6:135857807-135857829 TTTCAGATGTATTAAGTGGAGGG + Intronic
1015689969 6:135910951-135910973 TCTCAGAAGCATGACTAAGAAGG + Intronic
1015874027 6:137804386-137804408 TTTCAGAAACAAGAAGAAAAGGG + Intergenic
1016117686 6:140308134-140308156 TTCCAGAAAAATGAAGAGAATGG + Intergenic
1017033187 6:150242232-150242254 TTCCAGAAACTTGAAAAGGAAGG + Intronic
1017187623 6:151618000-151618022 TTTCATAATCAGGAAGAGCAAGG - Exonic
1017515816 6:155154867-155154889 TTTTAAAATCATAAAGAGGACGG + Intronic
1017593465 6:156002688-156002710 TTTCAGAAAACTGAAGAGAAGGG - Intergenic
1017775793 6:157679923-157679945 TTTCAGAAGCATGCAGTGAAGGG - Intergenic
1017986955 6:159452520-159452542 TTCTAGAAGCCTGAACAGGAGGG - Intergenic
1018083768 6:160282247-160282269 TTCCAGGAACTTGAAGAGGAAGG - Intergenic
1018201516 6:161399624-161399646 TTTCAGCAGTAAGAAGAGGAAGG + Intronic
1018288581 6:162266810-162266832 TTTCAGAAAACTAAAGAGGATGG + Intronic
1019125278 6:169835511-169835533 TTTCAGAAAATAGAAGAGGAAGG + Intergenic
1019769580 7:2875281-2875303 TTCCAGAAGCAGGAAGAGACAGG - Intergenic
1019873322 7:3787932-3787954 TCTCAGAAGTCTGAAGAGAAAGG + Intronic
1019932811 7:4234834-4234856 TCTCAGCAGCATGAAGGGCAGGG + Intronic
1020489318 7:8759626-8759648 TTACAGAAGCATGAAGGAGATGG + Intergenic
1020580763 7:9997458-9997480 TTCCAAAAACCTGAAGAGGAAGG + Intergenic
1020695143 7:11404642-11404664 TTTCAGCAGCAGGAAGTGAAAGG + Intronic
1021973657 7:25989947-25989969 TGTCAGAACCACGAAGTGGAAGG + Intergenic
1022481934 7:30749939-30749961 TTGCAGTAGCCTGGAGAGGATGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023276796 7:38528278-38528300 TTTCAGAAAATAGAAGAGGAGGG - Intronic
1023451274 7:40288206-40288228 TTCCAAAAGCAAGGAGAGGAGGG - Intronic
1023587406 7:41744892-41744914 ATTCAGAAGAAAGAAAAGGATGG - Intergenic
1024097374 7:45993604-45993626 TTTCAGAAGAATACAGAGGAGGG - Intergenic
1024489563 7:49963834-49963856 TTTCAGAATACAGAAGAGGAAGG + Intronic
1024871314 7:53964491-53964513 TTTCACAGGCAGGAAGAAGATGG - Intergenic
1024954291 7:54900195-54900217 TTTTATAAGGATGAAGAGGTGGG + Intergenic
1026599607 7:71766423-71766445 TTTCAGAAGGCTGAAGCAGAGGG - Intergenic
1027614452 7:80404032-80404054 TTCCAGGAGCATGAAGATAATGG - Intronic
1027983602 7:85257005-85257027 TTAAAGAAGCAAGAAGAGTAGGG - Intergenic
1028387283 7:90270510-90270532 TTTAAAAAGTAAGAAGAGGAAGG - Intronic
1028429085 7:90726222-90726244 TTTCTGAATCATTAAGAGGTTGG - Intronic
1028839103 7:95407938-95407960 TCACAGGAGCAAGAAGAGGAAGG + Intronic
1030066905 7:105666781-105666803 TTTCAAAAGCTTCAACAGGATGG - Intronic
1030435974 7:109521107-109521129 TTTCATAAGCATGAAAAAGAAGG - Intergenic
1030767789 7:113433201-113433223 TTTCAGAAAATTGAAAAGGAGGG - Intergenic
1031039465 7:116823862-116823884 TTTCAGAAAATTGAGGAGGAGGG - Intronic
1031228825 7:119077763-119077785 TACCATAAGCATTAAGAGGATGG + Intergenic
1032632330 7:133667337-133667359 TTTCAGAAGCATTTGGAAGAAGG - Intronic
1032744606 7:134773241-134773263 TTACAGAAAAATGAAGAAGAAGG - Intronic
1032901243 7:136311132-136311154 TGTCAGAACCCTGGAGAGGAAGG + Intergenic
1032945237 7:136844286-136844308 TTTCTGAAGGATGAAGAGGAAGG + Intergenic
1033937133 7:146600170-146600192 TTTCAGGAGCAGGAAAATGAAGG + Intronic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1036126012 8:6062738-6062760 ATTCGGAAGCCTGAAGTGGAAGG - Intergenic
1036205789 8:6805037-6805059 TTTCATATGCATGAAGAGAGAGG + Intergenic
1036600072 8:10252610-10252632 TTGCAGAAGCTTGAAAGGGAGGG - Intronic
1036977502 8:13430497-13430519 TTTCAAAAGAATGAAAATGAGGG - Intronic
1037119826 8:15269442-15269464 TTCCAAAAAAATGAAGAGGAAGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037956221 8:23062064-23062086 TTTCAAAAACTTGAAGAGAAGGG - Intronic
1040107644 8:43549533-43549555 TTTCAGAAGGATGTTGAGGCAGG - Intergenic
1041486117 8:58378304-58378326 TTTCATAAGCATCCAGAGTAGGG - Intergenic
1041905767 8:63031907-63031929 CTTTAGCAGCATGAAAAGGATGG + Intronic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1043323763 8:79024518-79024540 TGTGAGAGGTATGAAGAGGAAGG + Intergenic
1043352724 8:79379576-79379598 TTCCAGAAGGCTGAAGAGGAGGG + Intergenic
1043996608 8:86825304-86825326 TGTCAGAAGAATAAATAGGATGG + Intergenic
1044464745 8:92489871-92489893 AATGAGAAGCATGAAAAGGAGGG - Intergenic
1044498391 8:92919674-92919696 TTTCAAAACATTGAAGAGGAGGG - Intronic
1044890467 8:96829634-96829656 TTTCAGTAGCCTGAAAATGAGGG - Intronic
1045966633 8:108032598-108032620 TTTCAGAAGCATAATAAGCAGGG + Intronic
1046518646 8:115296097-115296119 TTTCAGAAGATTGATGAAGAAGG - Intergenic
1046657143 8:116907066-116907088 TTTCACAGGCATGGAGAGGGTGG + Intergenic
1047700861 8:127448131-127448153 TTTCACAGGGAGGAAGAGGAAGG + Intergenic
1047924905 8:129673358-129673380 TTTTAAAAGTGTGAAGAGGAAGG - Intergenic
1048238619 8:132718071-132718093 TTTCAGGAGGTGGAAGAGGAAGG + Intronic
1048640679 8:136356539-136356561 TTTCAGAAAATTGAAGTGGAGGG - Intergenic
1048905486 8:139084104-139084126 TTTCAGACAGATAAAGAGGAAGG - Intergenic
1049062944 8:140290291-140290313 TTTCAGCAGCACGCAAAGGAGGG - Intronic
1049234085 8:141501607-141501629 TTCCAGAAAATTGAAGAGGAGGG + Intergenic
1049620596 8:143596735-143596757 TTTCAGAGGCTTTAAGTGGAAGG - Intronic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050580639 9:7051735-7051757 TTCCAGTTGTATGAAGAGGAAGG - Intronic
1051656868 9:19390813-19390835 TTTCAGAAAATAGAAGAGGAAGG + Intergenic
1051837312 9:21355144-21355166 TTCCATAAGATTGAAGAGGAGGG + Intergenic
1052582176 9:30372586-30372608 TTTCAGAAAATTGAAGAGGAGGG + Intergenic
1052584633 9:30410933-30410955 TGTCAAAAACTTGAAGAGGAAGG - Intergenic
1052783670 9:32807958-32807980 TTTCAGAAGACAGAAGAAGAGGG + Intergenic
1053331112 9:37208380-37208402 TTTCAGAAGCTTTAATAGGCCGG - Intronic
1053706795 9:40762392-40762414 TATCAGAAGCATGAATAAAATGG + Intergenic
1053724262 9:40981567-40981589 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1054341707 9:63870434-63870456 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1054357329 9:64073378-64073400 TTTCAGTTGCATCAACAGGATGG + Intergenic
1054416709 9:64883158-64883180 TATCAGAAGCATGAATAAAATGG + Intergenic
1054894465 9:70293027-70293049 TTTCAGAAAGTAGAAGAGGAAGG - Intronic
1054976038 9:71146611-71146633 TTCCAGAAGAATGGAGAAGAAGG - Intronic
1055131623 9:72781918-72781940 TTTCAAAAACTTGAGGAGGAGGG + Intronic
1055229760 9:74048558-74048580 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1055372458 9:75614740-75614762 ACTCAGAAGGATGAAGAGGGTGG - Intergenic
1055378508 9:75679263-75679285 TTTCATATTCATGAATAGGAAGG + Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055562956 9:77539542-77539564 TTCCAAAAGATTGAAGAGGAGGG - Intronic
1055779549 9:79804915-79804937 CTTCACAAGCAGGAAGAGGCAGG - Intergenic
1056059294 9:82867014-82867036 TTCCAGAAAATTGAAGAGGATGG + Intergenic
1056975013 9:91245138-91245160 TGGCACAAGCATGAAGAGCAGGG + Intronic
1057003640 9:91536115-91536137 TTTCAGAAGGATGTACAGCATGG + Intergenic
1057493859 9:95544337-95544359 TTTCAGAAGCAGTAAGAGACTGG - Intergenic
1057825627 9:98370303-98370325 TTTCACCTGCATCAAGAGGACGG + Intronic
1057879800 9:98784576-98784598 TTTCAGATGCAGGAAGAGCTAGG + Intronic
1058400833 9:104617422-104617444 CTTCATATACATGAAGAGGATGG + Exonic
1058473979 9:105311908-105311930 TTTCAGGAGAAAGAAGAGGATGG - Intronic
1058613020 9:106795280-106795302 TTTCAGAAGAGTGAATAGCAGGG - Intergenic
1059106372 9:111515246-111515268 TTTCAGGAGCATGAAAATAATGG - Intergenic
1059394215 9:114022298-114022320 CTTCAGAAAATTGAAGAGGAGGG - Intronic
1060772902 9:126345779-126345801 TTTCAGAAACATGAAGAAAGAGG - Intronic
1061743364 9:132723034-132723056 GTTCAGAGGCATGAAAATGATGG - Intergenic
1062571190 9:137186129-137186151 CTTCAGAAGCATCCAGAGCACGG - Intronic
1203450538 Un_GL000219v1:110452-110474 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187553242 X:20326798-20326820 TCTCAAAATTATGAAGAGGAGGG - Intergenic
1187892895 X:23953883-23953905 TTCCAGAAAATTGAAGAGGAGGG + Intergenic
1187919557 X:24187869-24187891 CTTTAGAAGCACTAAGAGGATGG + Intronic
1188202883 X:27314226-27314248 TTCCAGAAAACTGAAGAGGAGGG + Intergenic
1188408514 X:29842204-29842226 TTTCAGAAGCATAAATATTATGG + Intronic
1189951999 X:46241874-46241896 TTTTAAAAGATTGAAGAGGAGGG + Intergenic
1190308261 X:49099020-49099042 TCTCAGAAACATCCAGAGGAGGG + Intronic
1190939657 X:55028144-55028166 TTTCACAAGCAGGCAGGGGAAGG - Intronic
1191041207 X:56081987-56082009 TTTCAAAACATTGAAGAGGAGGG - Intergenic
1191744532 X:64471710-64471732 TTCCAAAAACCTGAAGAGGAGGG - Intergenic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1192198012 X:69044505-69044527 TTCCAGAACACTGAAGAGGAGGG - Intergenic
1192246452 X:69376467-69376489 TTCCAGAAAATTGAAGAGGAAGG + Intergenic
1192296829 X:69858766-69858788 TTTCAAAAAAATGATGAGGAGGG - Intronic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1192540191 X:71962345-71962367 CTTCAGAATATTGAAGAGGAGGG - Intergenic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1193012703 X:76695661-76695683 TTTCAAAAACTTGAAGAGGAGGG + Intergenic
1193493481 X:82180648-82180670 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1193646532 X:84076269-84076291 TTTCAGAAATTTGAAGAGGAGGG + Intronic
1193693402 X:84676522-84676544 TTCCAGAAAATTGAAGAGGAAGG - Intergenic
1194291825 X:92082739-92082761 TTACAGAAGCATTAACATGATGG + Intronic
1195999921 X:110771289-110771311 TTCCAGAAAACTGAAGAGGAGGG + Intronic
1196076399 X:111581737-111581759 TTTCAAAAGATTGAAGAGAAGGG - Intergenic
1196418569 X:115499476-115499498 TTTCAGAAGCCAAAAGAGGGAGG + Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1196998548 X:121411926-121411948 TTACAAAATAATGAAGAGGAGGG - Intergenic
1197375784 X:125680592-125680614 TTCCAGAAACATGAAGATAATGG - Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1198473624 X:136974189-136974211 TTTTAGAAGAATAAAGAGTAAGG - Intergenic
1198629775 X:138623337-138623359 TTCCAAAAAAATGAAGAGGAAGG - Intergenic
1198639407 X:138740569-138740591 TTTCAGCAGTAGGCAGAGGATGG + Intronic
1199201635 X:145096895-145096917 TATCAGCAGCATGAATAGGAGGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199857430 X:151771815-151771837 TTTCAGAGACCTCAAGAGGATGG - Intergenic
1200244032 X:154513240-154513262 TTTCAGAGGCAGGAAGTTGAGGG - Intronic
1200609341 Y:5307311-5307333 TTACAGAAGCATTAACATGATGG + Intronic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic