ID: 999788783

View in Genome Browser
Species Human (GRCh38)
Location 5:154917757-154917779
Sequence CTGTAGTTCTCAAAGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999788782_999788783 15 Left 999788782 5:154917719-154917741 CCAAATACTCTCAATGGGCTGAA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG 0: 1
1: 0
2: 0
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999788783 Original CRISPR CTGTAGTTCTCAAAGACACA AGG Intronic
901349899 1:8585195-8585217 TTCTGGTTCTCAAGGACACAAGG - Intronic
902111782 1:14085154-14085176 CTGTGGTTCTCAGAGATAAATGG - Intergenic
902132880 1:14279059-14279081 CTGTATTTATCATAGACATAAGG + Intergenic
903018432 1:20377000-20377022 CTGTGATTCTCAGAGACCCAGGG - Intergenic
903465276 1:23547934-23547956 CTGAATTTCTCAAAGACAGAAGG - Intergenic
908085464 1:60627822-60627844 CAGTAGTTGCCAAAGACAAAGGG - Intergenic
908891534 1:68854329-68854351 CTGTACTTTTCATAGAGACAGGG + Intergenic
910229998 1:84975443-84975465 CTGTGGTTCTTATAGACTCATGG - Intronic
911798971 1:102109991-102110013 CTGTACTCCACAAAGCCACAGGG - Intergenic
912604367 1:110973330-110973352 GTGTAAGTCTCAAAGTCACAGGG + Intergenic
912797849 1:112703672-112703694 ATATAGTTCTCAAAGACAGTAGG + Exonic
912947198 1:114095304-114095326 TTAGAGTTCTCAAAGAAACAGGG + Intronic
913023280 1:114808806-114808828 TTGTAGTTTTCATAGAGACAGGG - Intergenic
914322138 1:146575447-146575469 CTGTGGTTTTAAAAGGCACAAGG + Intergenic
915233657 1:154464784-154464806 TTGTATTTCTCATAGAGACAGGG - Intronic
916006771 1:160668959-160668981 TTGTTGTTCTCAAATGCACATGG - Intergenic
916700890 1:167293718-167293740 CTGTAGTTACCAAAGCAACATGG + Intronic
917912040 1:179659186-179659208 ATGTTTTTTTCAAAGACACATGG - Intronic
917989983 1:180364905-180364927 CTGTAGTTTTAATAGAGACAGGG + Intronic
918119941 1:181529573-181529595 CTGTACTTCACAAAGCCACAGGG + Intronic
919790936 1:201290525-201290547 CTGCAGCTCTCAAATACCCAAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921743140 1:218709057-218709079 TTGTATTTCTCATAGAGACAGGG + Intergenic
921800561 1:219398381-219398403 CTGTAGTGCTAAAAAACTCATGG - Intergenic
922639588 1:227214943-227214965 CTGCAATTCTCAAAGACAAAAGG + Intronic
923091177 1:230742487-230742509 CTGTATTTCTAATAGAGACAGGG + Intergenic
924284992 1:242476839-242476861 CTGCAGTTCACACATACACAGGG + Intronic
1064931735 10:20636198-20636220 CTGTAGTTGACTGAGACACAAGG + Intergenic
1065362998 10:24906831-24906853 CTTTGGTTCTAAAAGGCACAGGG + Intronic
1068344621 10:55758274-55758296 CTGTAATTCTCAAATACTGATGG + Intergenic
1069415494 10:68196921-68196943 TTTTATTACTCAAAGACACAGGG + Intronic
1070861922 10:79676062-79676084 CTGTAATTCTCAAATACTGATGG - Intergenic
1070875221 10:79798523-79798545 CTGTAATTCTCAAATACTGATGG + Intergenic
1071642150 10:87320695-87320717 CTGTAATTCTCAAATACTGATGG + Intergenic
1072010600 10:91299708-91299730 CTGTGGTTCTCAAAGTCAGCCGG + Intergenic
1072833005 10:98679154-98679176 CCCTCATTCTCAAAGACACATGG - Intronic
1073964948 10:108978251-108978273 CTGTACTTTCCAAAGTCACAGGG + Intergenic
1075501914 10:122982598-122982620 CTGTAGTTCTCTAACACACCTGG - Intronic
1075853890 10:125611437-125611459 CTGTTGTCATCAAAGACACATGG - Intronic
1075879463 10:125837957-125837979 CTGTCCTTCTTAAAGACACATGG + Intronic
1076764441 10:132625327-132625349 CAGTAATTCAGAAAGACACAGGG - Intronic
1078100375 11:8327041-8327063 CTGTAGTTTTCCAAGTCAAATGG + Intergenic
1079433067 11:20415638-20415660 CTGTAGTTCTCAAAGCTAGCTGG + Intronic
1079961475 11:26929409-26929431 CTCTAGTTCTAAAACACAGAAGG + Intergenic
1080172014 11:29315857-29315879 CTGTAGTTTCCAAGGAAACAGGG - Intergenic
1080638598 11:34144890-34144912 CTATAGTTCCTAGAGACACAAGG - Intronic
1080798517 11:35588131-35588153 CTGTATTTTTCACAGAGACAGGG - Intergenic
1081278804 11:41183576-41183598 CTGTACCCTTCAAAGACACAGGG - Intronic
1083785059 11:64940071-64940093 CTGCAGTTATCACAGAAACAGGG - Intronic
1085778989 11:79391434-79391456 CAGTAGTTCCCAAAGACATGTGG - Intronic
1085844355 11:80048708-80048730 CTCTAGTTCTCAGAGCCAGAAGG + Intergenic
1085981527 11:81732365-81732387 CTGTAGTTCTTGCAGACACATGG + Intergenic
1088872012 11:113898611-113898633 TTGTAGTTTTCGTAGACACAGGG + Intergenic
1090735476 11:129609172-129609194 CACTAGTTCTCAAAGACTCTGGG + Intergenic
1091960736 12:4692006-4692028 CTGTCTTTCTCAAGGACCCAGGG - Exonic
1094532878 12:31294000-31294022 CTGTGGTTCTCAAATAGGCACGG - Intronic
1094576776 12:31693841-31693863 CTGTATTTTTCATAGAGACAAGG + Intronic
1096372634 12:51082196-51082218 CTGGTGATCACAAAGACACATGG - Intronic
1098392576 12:69985172-69985194 TTGTAGGTCTCAAAGGAACAAGG - Intergenic
1098423619 12:70333170-70333192 CTATAGTTCTCACAGTGACAGGG - Intronic
1099042671 12:77675825-77675847 CTATAGTCCACAAACACACAAGG - Intergenic
1099471425 12:83053941-83053963 CTGTGGTTCTCTAAAACAAAGGG - Intronic
1099652067 12:85441371-85441393 CTGTAGTTATAAATTACACAGGG + Intergenic
1100278203 12:93091858-93091880 CTGCAGTTCTCAAAGAACAAGGG + Intergenic
1101611929 12:106300810-106300832 ATGTAGCTCTCAAAGCCACCAGG - Intronic
1102437167 12:112933712-112933734 TTGTATTTCTCATAGACACAGGG - Intergenic
1102452052 12:113049275-113049297 CTGTGGTCCCCAAAGACAAAGGG + Intergenic
1105374532 13:19831433-19831455 CTGTATTACTGAAATACACATGG + Intronic
1105554613 13:21434259-21434281 TTCTGGTTCTCAAGGACACAAGG + Intronic
1107030521 13:35847926-35847948 CTATAGTGCTGAAAGCCACATGG - Intronic
1110820580 13:79910596-79910618 CTGTTGTTCTTAAAGCCCCAGGG - Intergenic
1112459316 13:99589350-99589372 CTGTAGTTTTCAAATAGACCTGG - Intergenic
1114217090 14:20665144-20665166 CTGTATCCTTCAAAGACACAGGG - Intergenic
1114920353 14:27318839-27318861 CTGAAGTTCTCACACACACCTGG - Intergenic
1116666088 14:47777477-47777499 CTGTGTTTCCCAAAGAAACAGGG - Intergenic
1118889632 14:69897234-69897256 CTGCAGTTCTGAAAGAGACCTGG - Intronic
1120861523 14:89259054-89259076 CTGTAGTCTTCAAAGCCACCAGG - Intronic
1121739017 14:96238513-96238535 CTGTAGTTCCTTAAGACTCAGGG + Intronic
1122243727 14:100386028-100386050 CTGCAGTTCTGAAACACAGAAGG + Intronic
1124459601 15:29877387-29877409 TTGTATTTTTCATAGACACAGGG + Intronic
1125710106 15:41778005-41778027 CTGTATTTATCAGAGCCACAGGG + Intronic
1126350973 15:47744540-47744562 CCGTATTTCCCAAGGACACATGG + Intronic
1127753336 15:62067562-62067584 CTGCAGTGCACAAAGGCACAAGG - Intronic
1129345300 15:74914052-74914074 CTGTAGTTTTAATAGAGACAGGG + Intergenic
1129609800 15:77044190-77044212 CTGTAGTTCTCAAAGTGCCCCGG + Exonic
1130063465 15:80586118-80586140 CTGCATTTCTCCAAGAAACAAGG - Intronic
1130853555 15:87821149-87821171 CTGTGATTCTCAATGATACAGGG - Intergenic
1131521897 15:93122669-93122691 CTGTAGTTCCCAGAGCCGCAGGG - Intergenic
1133833070 16:9342115-9342137 CTGTAGGGCTCAGAGGCACAGGG + Intergenic
1134799305 16:17069962-17069984 CTTCAGTTCTCAAAAACACATGG + Intergenic
1136543732 16:30943673-30943695 CTGTAATTCTTATAGAAACAGGG + Intronic
1138333964 16:56237605-56237627 CTGTGCTTCCCAAAAACACATGG - Intronic
1138953053 16:61937243-61937265 CTATAGTTCTCAAAGACTTGGGG + Intronic
1139565732 16:67774643-67774665 CTCTAGGTGTCAATGACACAGGG + Intronic
1140011487 16:71135719-71135741 CTGTGGTTTTAAAAGGCACAAGG - Intronic
1142057688 16:88009386-88009408 CTGTGGTTCTCTAAGACTTAAGG - Intronic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1145123053 17:20277984-20278006 CTTTGGTTCTGGAAGACACAAGG - Intronic
1145407604 17:22619031-22619053 CTGTAGCTCTCAAATACTGATGG + Intergenic
1147359968 17:39924308-39924330 CTGGAGTTCTCAGGGAAACAAGG - Intronic
1148398614 17:47332610-47332632 ATGTTGTTCTCATAGAAACAGGG - Intronic
1152932439 17:83116695-83116717 CTGTCGTCCTCAGAGACTCATGG + Intergenic
1156573861 18:38290300-38290322 ATGAAGTTCTTAAAGACACAAGG - Intergenic
1156735673 18:40255898-40255920 CTCTAGGTCTCATAGACAAAGGG + Intergenic
1157916537 18:51669145-51669167 CTGTTGTATTCCAAGACACAGGG - Intergenic
1159616859 18:70591275-70591297 CCTTAGCTCTCAAATACACATGG + Intergenic
1160536742 18:79598461-79598483 CTCTCGTTCTCAGAGACAAAGGG - Intergenic
1162361821 19:10224931-10224953 CTGCAGTTCTGAAAGCCCCATGG - Exonic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
925225438 2:2180073-2180095 CTGTTGTTATCAAAGAAACTAGG + Intronic
928624797 2:33128660-33128682 CTCTAGTTCCCAAAAACCCAGGG + Intronic
929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG + Intronic
930741135 2:54833832-54833854 CTGCAATTCTCAAAGCCAAAAGG + Intronic
930780996 2:55224739-55224761 CTGATGTTCTCATGGACACAAGG - Intronic
931413702 2:62060154-62060176 CTGTATTTTTCATAGAGACAGGG - Intronic
932795411 2:74691243-74691265 CTGCAGTTCTCAGAGACTGATGG - Intergenic
934125320 2:88882814-88882836 AGGTTGTTCACAAAGACACAAGG + Intergenic
934616330 2:95773480-95773502 CTGAAGTTTGCAAGGACACATGG + Intergenic
934644566 2:96051080-96051102 CTGAAGTTTGCAAGGACACATGG - Intergenic
934837981 2:97607170-97607192 CTGAAGTTTGCAAGGACACATGG - Intergenic
936325863 2:111505228-111505250 TTGTAGTTCTTATAGAGACAGGG + Intergenic
936587809 2:113773740-113773762 CTGAAGTTCACAAAAAGACATGG + Intergenic
938336575 2:130505496-130505518 ATGTAGTTTTCAAAGACGGAAGG + Intronic
938353243 2:130615166-130615188 ATGTAGTTTTCAAAGACGGAAGG - Intronic
939410057 2:141813670-141813692 CTGTAGTTCTGCAAGTGACAGGG + Intronic
939504724 2:143031549-143031571 CTGTAGTTTTTATAGAGACAAGG - Intronic
940405973 2:153302925-153302947 CTATAGTAATCAAAAACACATGG - Intergenic
940480372 2:154221907-154221929 CTGTAATTCTCAAAGAGAAATGG + Intronic
940683892 2:156821934-156821956 GTGGAGTTCTCCAAGAAACATGG - Intergenic
942324757 2:174766766-174766788 CTTGAGTTCCCAAACACACACGG + Intergenic
944120071 2:196231175-196231197 CTCTGTTTCTAAAAGACACAGGG - Intronic
1169587155 20:7097492-7097514 CTGTAGTTCTTGAAGACTCATGG - Intergenic
1169798569 20:9492580-9492602 TTGGAGCCCTCAAAGACACAGGG + Intergenic
1169909772 20:10637794-10637816 CTGGAGTTCTCAAAGACCTGGGG - Exonic
1170109349 20:12788120-12788142 CCATGGTTCTCACAGACACAGGG + Intergenic
1170220851 20:13940100-13940122 CTGTATTTCTTACAGACAAATGG - Intronic
1170565456 20:17599686-17599708 CTGTAGTTGTCAAAGACATTGGG + Intronic
1170758262 20:19224259-19224281 CTTTTGTACTAAAAGACACATGG - Intronic
1170895220 20:20406737-20406759 CTGTATTTCTTATAGAGACAGGG - Intronic
1171042406 20:21777710-21777732 CTGAAGTAGTCAAAGACACGAGG - Intergenic
1173670837 20:44797818-44797840 CTGCACATATCAAAGACACATGG - Intronic
1173756847 20:45524208-45524230 CAGTAGTTCCCAAACTCACACGG + Intergenic
1181992205 22:26845816-26845838 CTGTCGTCCTGAAACACACAGGG + Intergenic
1184617689 22:45649011-45649033 TTGTAGTTCACAAAGGAACAGGG + Intergenic
951604873 3:24422091-24422113 ATGTAGTTTTCAAAAACAAAGGG + Intronic
953829876 3:46287045-46287067 CTGTAGTTGTCAGAGACAACAGG + Intergenic
955046590 3:55366834-55366856 CTGATGTTCTCAAGGACACTGGG + Intergenic
955107196 3:55909509-55909531 GTGTAGATCTCACAGACAGAAGG + Intronic
956088901 3:65643109-65643131 CTGCAGTTCAGAAAGTCACATGG - Intronic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
957218045 3:77347145-77347167 GTTTAGTTCTCAGTGACACAAGG + Intronic
957232899 3:77543582-77543604 CTGTACTTCTAAAGTACACATGG + Intronic
957529578 3:81424104-81424126 CTGTAGATCTCAAGGCCAAATGG - Intergenic
957857828 3:85901022-85901044 TTGTATTTTTCATAGACACAGGG - Intronic
957913577 3:86655861-86655883 TTGTATTTTTCAAAGAGACAGGG - Intergenic
958993166 3:100871322-100871344 ATGTAGTTTTTAAAGAAACATGG + Intronic
959597550 3:108144389-108144411 TTGTATTTCTCATAGAGACAGGG - Intergenic
961342554 3:126238260-126238282 CTGTACCCCACAAAGACACAGGG - Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
965828971 3:172760891-172760913 TTGTAGTTTTCATAGAGACAGGG + Intronic
966079980 3:175989132-175989154 CTATGATTCTCAAAAACACAAGG - Intergenic
966654687 3:182342506-182342528 CTGTAGTTTTCAAGGTTACAGGG - Intergenic
973876961 4:55229755-55229777 CTGCAGTTCTCAACAGCACATGG - Intergenic
974071490 4:57128019-57128041 CTGTACCCCTCAAAGCCACAGGG + Intergenic
976663503 4:87565226-87565248 CTGTAGTTCTAAAAAGCAAAGGG + Intergenic
977558371 4:98507585-98507607 CTGTGGTTGTCAAAGAGAAAGGG + Intronic
977983694 4:103357331-103357353 CAGTGGTTCTCTAAGAAACATGG + Intergenic
978383513 4:108155958-108155980 CTGTCCTTTTCAAATACACATGG - Intronic
979146209 4:117251740-117251762 CTGTATTCTTCAAAGTCACAGGG + Intergenic
980027510 4:127783232-127783254 CTGCAGTTCTCAAGGGCACTGGG - Intronic
980350760 4:131680758-131680780 CTGTACCTTTCAAAGCCACAGGG + Intergenic
983301989 4:165937324-165937346 CTTTGGCTCTCAAGGACACAGGG + Intronic
983458186 4:167991472-167991494 CTGTAGTTTTTATAGAGACAGGG + Intergenic
983466519 4:168099776-168099798 CTGTAGCACTCAGAGACATATGG - Intronic
983716870 4:170792595-170792617 CTGCAATTCTCACTGACACATGG + Intergenic
983889778 4:173018734-173018756 CTGTAGTTCTCACACAAACCAGG - Intronic
984611814 4:181848993-181849015 CTGTAGCTCACAAAAACAAATGG - Intergenic
985054374 4:186023617-186023639 CTCTAGTTCTTAAAATCACAAGG + Intergenic
985085826 4:186311520-186311542 CTGTAGCTGGAAAAGACACAAGG + Intergenic
985872138 5:2565352-2565374 CTGATGTTCTCAAAGACTCATGG + Intergenic
986595482 5:9417552-9417574 TGGTAGTTCTCAAAGTTACAAGG + Intronic
987314253 5:16709564-16709586 CTTCAGTCCTCAAAAACACAGGG + Intronic
987663640 5:20907965-20907987 CTGTATTTTGCAAAGCCACAGGG + Intergenic
987767875 5:22258295-22258317 CTATAGTTTTGAAAGACAAAAGG + Intronic
988354452 5:30155225-30155247 CTGGAGTTCTGAAAGACATCAGG - Intergenic
988759045 5:34294224-34294246 CTGTATTTCGCAAAGCCACAGGG - Intergenic
989672662 5:43936644-43936666 CTGTAGTACAAAAAGACACCAGG + Intergenic
991484746 5:67123274-67123296 CTGTAGTGCTAAAACACACATGG + Intronic
992204696 5:74420108-74420130 CTGTATTTTTAAAAGACACAAGG - Intergenic
992563423 5:77974207-77974229 CTGTAGTTTTAATAGAGACACGG + Intergenic
993878190 5:93333130-93333152 CTATAGTTCACAAGAACACATGG + Intergenic
993997888 5:94744350-94744372 CTGTACTTCTAAAATGCACAGGG + Intronic
994285211 5:97956194-97956216 CTGTACTTTGCAGAGACACAGGG + Intergenic
994845660 5:104986250-104986272 CTGTGGTTCTCACAGACTCATGG + Intergenic
995017370 5:107326185-107326207 CTGAAGTTCTGCTAGACACATGG + Intergenic
996523463 5:124452251-124452273 CTGGAGTTTTCAAAAATACAGGG + Intergenic
998026491 5:138820448-138820470 CTGCAGTTCTCATAGGCACTAGG - Intronic
998944938 5:147328463-147328485 CTATCGTTGTTAAAGACACAGGG + Intronic
999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG + Intronic
1001145101 5:169176957-169176979 CTCCAGTTCTCAAAGGCAGAGGG - Intronic
1003133819 6:3417682-3417704 CAGTAGTTCTCAGAGTCGCAGGG - Intronic
1003510855 6:6779122-6779144 CTGTAATCCTAAAAGACATATGG + Intergenic
1004261113 6:14108783-14108805 CTGTGGTTCTCAATGGCCCATGG + Intergenic
1004349441 6:14878336-14878358 CTGGAATTCACAAAGACTCAAGG + Intergenic
1006253471 6:32810723-32810745 CTCTGGTTTTCAAGGACACAGGG - Intergenic
1006704279 6:36004247-36004269 TTGTAGTTTTCATAGAGACAGGG + Intronic
1007128575 6:39448345-39448367 TTGTAGTTTTCATAGAGACAGGG + Intronic
1008941340 6:57048829-57048851 CTGTGTTTCTCAACGGCACATGG - Intronic
1009769092 6:68121741-68121763 CTGTACTTTGCAAAGCCACAAGG - Intergenic
1009956987 6:70467426-70467448 CTGAAGTACTCAAAGACCCAAGG - Intronic
1010082690 6:71882781-71882803 ATTTATTTCACAAAGACACATGG + Intergenic
1015183041 6:130381604-130381626 CTGCAGTTGTCACAGAAACATGG - Intronic
1016675105 6:146756040-146756062 CTGTAGTTGTTAAAGAGAGAGGG - Intronic
1017218207 6:151935114-151935136 ATGTAATTTTCAAAGCCACAAGG - Intronic
1017445990 6:154508348-154508370 CTGTAAGTCTAAAATACACATGG - Intronic
1018044613 6:159954806-159954828 CTGTCCTTCTCCAAGACACCTGG - Intergenic
1021260204 7:18446722-18446744 ATGTTGTTCTCAATGACACTTGG - Intronic
1021516564 7:21494898-21494920 GTGTAGTTTTGAAGGACACATGG + Intronic
1025299576 7:57807408-57807430 CTGTATTTCTGGTAGACACAGGG - Intergenic
1026391754 7:69910116-69910138 CTGTATTTCTCAGATAAACATGG + Intronic
1026420634 7:70233451-70233473 CAGTAGTTGTGAAAGACACAAGG + Intronic
1027382478 7:77625424-77625446 TTGTATTTGTTAAAGACACAGGG + Intronic
1028948897 7:96611657-96611679 GTGAAATTCTCAAAAACACATGG - Intronic
1029862395 7:103586878-103586900 CTGTAGATCACAAAAACAAATGG + Intronic
1031138719 7:117917443-117917465 GTGTTATTCTCAAAGACAGAAGG + Intergenic
1032168529 7:129564847-129564869 TTGTAGTTGTCCAAGACAGAGGG - Intergenic
1035407871 7:158611804-158611826 TTGGAGTTCTCAAAGGTACAGGG + Intergenic
1035951769 8:4030050-4030072 CTGTATTCTTCAAAGTCACAGGG - Intronic
1037447549 8:18981448-18981470 CTCTATTTTCCAAAGACACAGGG - Intronic
1039457753 8:37718935-37718957 TTGTATTTCTCATAGAGACAGGG + Intergenic
1042511912 8:69620696-69620718 CGTTAGTTCACCAAGACACACGG - Intronic
1042890581 8:73605479-73605501 CTGTATTTTTCATAGAGACAGGG + Intronic
1046606002 8:116373154-116373176 CTGTACCTCACAAAGCCACAGGG - Intergenic
1048354021 8:133638902-133638924 CTATAGTTCTCAAAGACCTGTGG + Intergenic
1050883583 9:10736354-10736376 CTGTATTTTTAATAGACACAGGG - Intergenic
1051309854 9:15758203-15758225 CTGTACCTTGCAAAGACACAGGG + Intronic
1052238339 9:26240716-26240738 CAGTAGTTTTGAAAGACAAATGG + Intergenic
1057254903 9:93538261-93538283 CTGTAATTCTCAAAGGTAAAAGG - Intronic
1057481763 9:95450123-95450145 ATGTAGTCCTCAAAGTCATAAGG - Intronic
1058180720 9:101795186-101795208 CTGCAGTTTTCAAAGTCCCAGGG + Intergenic
1058228392 9:102395210-102395232 CTGTCTTTCTCAAAGACTTAGGG - Intergenic
1059620249 9:115996930-115996952 GTGTCTTTCTTAAAGACACATGG + Intergenic
1061742786 9:132719354-132719376 CTGTAGTTTTTGAAGAAACAGGG - Intergenic
1061998768 9:134205199-134205221 CTGGACCTCTCAAAGAGACAGGG - Intergenic
1203633937 Un_KI270750v1:94516-94538 TTGTATTTTTCATAGACACAAGG + Intergenic
1186949504 X:14607820-14607842 CAGTAGTGCTGACAGACACATGG + Intronic
1187468615 X:19548274-19548296 CTGTAATTCTGGAAGTCACAAGG + Intronic
1188025802 X:25208062-25208084 CTGAAGTTCTGAAGGACACCAGG - Intergenic
1188287953 X:28352210-28352232 CTGTGGTTTTAAAAGATACATGG + Intergenic
1188743385 X:33812249-33812271 ATGTACTTCTCAAATACATATGG - Intergenic
1189425490 X:40896604-40896626 GTGAAGTCCTCACAGACACAGGG + Intergenic
1192465483 X:71352519-71352541 CTATAGTTGTCAAAGACAGTGGG - Intergenic
1194526617 X:94984446-94984468 CTGTGGTTTTTAAAGACTCATGG - Intergenic
1194538985 X:95146766-95146788 TTGTATTTTTCAAAGAGACAGGG + Intergenic
1195156502 X:102128363-102128385 CTGAAGTTCTCAAGGTAACAAGG + Intergenic
1195698898 X:107687056-107687078 CTGAACTTATTAAAGACACAGGG - Intergenic
1197172959 X:123454793-123454815 CTCTAGCTTTCAAAGTCACATGG + Intronic
1197428833 X:126333537-126333559 CTGTAGTTATTTGAGACACAGGG - Intergenic
1199041411 X:143119296-143119318 CTGTACTTTGCAAAGCCACAGGG - Intergenic
1199560620 X:149159236-149159258 CTGTACCTCACAAAGCCACAGGG - Intergenic
1200274172 X:154716256-154716278 CTGTAGTACTCCAAGACATCGGG + Exonic
1201371743 Y:13271923-13271945 CTGCAGGTTTCAAAGACAGAAGG + Intronic
1201988550 Y:19996462-19996484 CTGTTGTTGTGAAAGACCCATGG + Intergenic