ID: 999789084

View in Genome Browser
Species Human (GRCh38)
Location 5:154921402-154921424
Sequence TATGTGCTAGAAATCTGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999789082_999789084 8 Left 999789082 5:154921371-154921393 CCAGGCTAAAGTATATACAGTCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 162
999789081_999789084 9 Left 999789081 5:154921370-154921392 CCCAGGCTAAAGTATATACAGTC 0: 1
1: 0
2: 0
3: 3
4: 152
Right 999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 162
999789079_999789084 11 Left 999789079 5:154921368-154921390 CCCCCAGGCTAAAGTATATACAG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 162
999789080_999789084 10 Left 999789080 5:154921369-154921391 CCCCAGGCTAAAGTATATACAGT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999789084 Original CRISPR TATGTGCTAGAAATCTGTGG AGG Exonic
903115359 1:21175554-21175576 TTTGTGGTAGAGATCTGAGGAGG - Intronic
906968894 1:50489612-50489634 TATGTGCTCCAAATCTGTTAGGG - Intronic
909839843 1:80306281-80306303 TTTGAGCTGCAAATCTGTGGGGG - Intergenic
915058857 1:153162701-153162723 TATGAGCTGGAAGTCTGAGGTGG - Intergenic
915922058 1:159983374-159983396 TATGTGCTGGAAGTCAGAGGGGG + Intergenic
916337626 1:163691396-163691418 TAAGTGCCAGAAATCTGGGATGG + Intergenic
918963745 1:191313099-191313121 CATGTTGTAGAAATCTGTAGTGG + Intergenic
920326843 1:205171772-205171794 AATATGCTAGAATTCTATGGAGG - Intronic
1063346473 10:5316703-5316725 TATTGGCTGTAAATCTGTGGGGG + Intergenic
1063724273 10:8619893-8619915 TCTGTACTAGATCTCTGTGGGGG + Intergenic
1066797265 10:39136432-39136454 TCTGTGAAAGAAATTTGTGGTGG + Intergenic
1067414555 10:46093639-46093661 TATGTGCTGTATATGTGTGGGGG - Intergenic
1067795835 10:49321095-49321117 TATGTGCTTGAAATTTGCTGAGG - Intronic
1068838061 10:61577901-61577923 GTTGTGCTACAAATCAGTGGAGG + Intergenic
1073826388 10:107328076-107328098 TATGTGATAGAAATATGTTATGG + Intergenic
1075823375 10:125333113-125333135 TATGTTCTGAAAATATGTGGTGG + Intergenic
1079011677 11:16833627-16833649 TGTGTGCTAGGAATCTGTCATGG + Intronic
1079633628 11:22708925-22708947 AATGTGCAAGAAGCCTGTGGTGG + Intronic
1080618746 11:33968591-33968613 TATATGCTAGAAAGCTCTAGAGG + Intergenic
1086643817 11:89194194-89194216 TATGTGCTTGACAGCTCTGGAGG + Intronic
1086865803 11:91978756-91978778 TTTGTGCTAGAATGCAGTGGGGG - Intergenic
1089809904 11:121123119-121123141 CATGTGCCAGAAATCAGTGTGGG + Intronic
1092785626 12:12023974-12023996 TGTGTGCTAGAAATGTAGGGAGG + Intergenic
1094429511 12:30352183-30352205 TAAGTGCTAGAAAGCAGAGGAGG + Intergenic
1096436741 12:51597380-51597402 TTTGTGCTATAAATTTTTGGGGG + Intronic
1098438586 12:70495540-70495562 TATGAGCCAGAAAACAGTGGGGG - Intergenic
1100852754 12:98730418-98730440 TATGTGATGGAATTCTGTGGAGG - Intronic
1102666941 12:114582345-114582367 AAAGTGATAGAAATCTGTGCAGG + Intergenic
1104377790 12:128280127-128280149 TATATGCCAGAAATCTCTGAAGG + Intronic
1104663451 12:130629462-130629484 TTTGTGCAAGCAATCTGTGAGGG + Intronic
1105844659 13:24283778-24283800 AATGTGCTGGAAAGCTGAGGAGG - Intronic
1107137691 13:36962118-36962140 TAGGTACTAGAAATCTGTAAAGG - Intronic
1109066294 13:57697319-57697341 TCTGTGCTAGAAATCTAAGATGG + Intronic
1109888688 13:68578138-68578160 TATGTAATAGAAATCTAGGGTGG + Intergenic
1112692468 13:101913250-101913272 ATTGTGTTTGAAATCTGTGGAGG + Intronic
1112942853 13:104886853-104886875 TATGTGTTATAGATCTATGGTGG + Intergenic
1113348138 13:109500665-109500687 TATGTGCAATAAATGTATGGAGG + Intergenic
1116224376 14:42129970-42129992 TATGTGGTAGGAATTAGTGGCGG + Intergenic
1117732055 14:58732963-58732985 TATGTGGTAGAAGGATGTGGGGG + Intergenic
1118099907 14:62586157-62586179 TATTTGCTAAAATTTTGTGGAGG + Intergenic
1125040709 15:35184017-35184039 TATGTCCTAGAAATCTGTCGTGG - Intergenic
1125052089 15:35311295-35311317 GATGTGATTGAAATCTGAGGGGG - Intronic
1125554635 15:40573899-40573921 GATGTGCTAGATCTCTGTGAGGG + Exonic
1128068796 15:64780737-64780759 TAAGTGCAAGAAGTCTCTGGAGG + Intergenic
1137678943 16:50321772-50321794 TATGGGCTAAAAACTTGTGGGGG + Intronic
1139531916 16:67546560-67546582 TCATTGCTAGGAATCTGTGGGGG - Exonic
1141019769 16:80484420-80484442 TATATACTAGAAATTTGAGGGGG + Intergenic
1144027334 17:11290025-11290047 TGTGTTCTAAATATCTGTGGTGG + Intronic
1144611381 17:16720463-16720485 TATATGCTATAAATCTTTCGAGG + Intronic
1144901356 17:18594894-18594916 TATATGCTATAAATCTTTGAAGG - Intergenic
1145131144 17:20351203-20351225 TATATGCTATAAATCTTTCGAGG + Intergenic
1146136352 17:30324228-30324250 TATGAGCAAGAAATATGAGGAGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1155238614 18:23845429-23845451 TATGTCTTAGGAATCTGTGCTGG - Intronic
1157985270 18:52430568-52430590 TTTGTGGTAGGAATCTATGGAGG + Intronic
1158765894 18:60449023-60449045 CATGTCCTAGGGATCTGTGGAGG - Intergenic
1159237205 18:65692325-65692347 AAGGCGCTAGAAATCTTTGGTGG + Intergenic
1159491653 18:69143128-69143150 TAAATGCTAGAAATCTTTGGTGG - Intergenic
1162440784 19:10690859-10690881 TGTGTGCTAGAAAACTTTTGAGG + Exonic
1164457878 19:28423700-28423722 TACGTGCAAGTAATCTGTGGAGG - Intergenic
1165687097 19:37831287-37831309 AATGGGCTTGAAAGCTGTGGAGG + Intergenic
1202657797 1_KI270708v1_random:40073-40095 TATCTGCCAGAAAAATGTGGGGG + Intergenic
926519666 2:13895451-13895473 TATGTGCTACTACTCTGTAGTGG + Intergenic
927295429 2:21447642-21447664 TTTGTTGTAGAAATCAGTGGAGG - Intergenic
929225038 2:39503825-39503847 CACCTGCTAGAATTCTGTGGCGG + Intergenic
932909660 2:75792351-75792373 TCTGTGCTGGACATCTGTGATGG + Intergenic
933504346 2:83158991-83159013 TATATGATTCAAATCTGTGGAGG + Intergenic
936001495 2:108835078-108835100 TATCTGCTGCAAATCTGTGTTGG + Intronic
938385868 2:130866769-130866791 CATCTGCTAGAATTCTGTTGAGG + Intronic
939432892 2:142133182-142133204 TATGTGGTAAAAGTCTTTGGTGG - Intergenic
939905106 2:147903540-147903562 TATGTGCTTAAAATATGTGTGGG + Intronic
940205883 2:151201337-151201359 TTTCTGCTAGACATCTGGGGAGG - Intergenic
940262471 2:151795856-151795878 TATGTATTTGAAATCTGTGTGGG - Intronic
940333094 2:152496645-152496667 TATGAGTTAGAATTCTGTGAGGG + Intronic
943423260 2:187697280-187697302 CCTGCCCTAGAAATCTGTGGAGG + Intergenic
943615363 2:190086110-190086132 TATGTGATAGATTTCTTTGGAGG - Intronic
1169709635 20:8547343-8547365 TATCTGATCCAAATCTGTGGTGG - Intronic
1171341491 20:24432152-24432174 TTTGGGCTAGAAGGCTGTGGGGG - Intergenic
1172491082 20:35338544-35338566 TATGTATTAGAAATCTTTTGGGG + Intronic
1174353746 20:49985088-49985110 TGTGTGCTAGGATTCAGTGGGGG - Intronic
1177485721 21:21753105-21753127 TATGTGTTAGAAATCAGTCTAGG + Intergenic
1178758476 21:35376708-35376730 TGTGTTAGAGAAATCTGTGGAGG - Intronic
951261083 3:20509779-20509801 TATTTGCTAGTATTTTGTGGAGG + Intergenic
952999988 3:38923748-38923770 GATGTGCCAGAGATTTGTGGGGG + Intronic
954178245 3:48861256-48861278 TACATTCAAGAAATCTGTGGGGG - Intronic
956108383 3:65845608-65845630 GATGTGGTAGAAATATGTTGAGG - Intronic
956582934 3:70834357-70834379 TATGTGTTAGAGATATGTTGTGG - Intergenic
958415225 3:93866015-93866037 TATGTGTTAGAAATAACTGGAGG + Intergenic
958445682 3:94211697-94211719 TATTTGCTAGGATTTTGTGGAGG - Intergenic
959175876 3:102909682-102909704 TATGTACTATAAATCAGTTGTGG - Intergenic
959596203 3:108131532-108131554 TCTCTGCTGGAAGTCTGTGGGGG + Intergenic
961973816 3:131000800-131000822 AATGTGTTTGAAAGCTGTGGTGG + Intronic
962014132 3:131423043-131423065 TCTGTGTGAGGAATCTGTGGTGG + Intergenic
963857897 3:150274774-150274796 TATTTGCCAGAATCCTGTGGGGG - Intergenic
964975104 3:162609186-162609208 GATGTGTTAGAACTCTTTGGGGG - Intergenic
965608992 3:170525429-170525451 TGTGGACTATAAATCTGTGGAGG + Intronic
966571927 3:181453592-181453614 TATTTGGTAAAACTCTGTGGAGG - Intergenic
966679138 3:182621784-182621806 TTTGTGCTACAATTCTGTGGGGG + Intergenic
967676422 3:192304235-192304257 AATGTGTTAAAAAGCTGTGGAGG - Intronic
967809438 3:193744549-193744571 TGTGTGCTAGAAATTAGAGGGGG + Intergenic
969115415 4:4867900-4867922 TATGTGCTGGGTATGTGTGGTGG - Intergenic
970138157 4:12949369-12949391 GATGAGCTGGAACTCTGTGGTGG + Intergenic
973657929 4:53069558-53069580 TAGATGATAGAACTCTGTGGTGG + Intronic
975110930 4:70625706-70625728 TCTGAGCTAGAACTCAGTGGTGG - Intergenic
976056451 4:81074185-81074207 GATGTGCTAGTAGTCTGTTGAGG + Intergenic
976834931 4:89361396-89361418 TATGTGTTAGAGATCTATAGTGG + Intergenic
978221548 4:106281799-106281821 TGTTTGCTAGTATTCTGTGGGGG + Intronic
978292059 4:107153108-107153130 TAGGTGCTAGAACTCAGTGGAGG + Intronic
978649491 4:110983320-110983342 TATGTACTAGAAACCTGTGAAGG - Intergenic
978873665 4:113610922-113610944 TATGTGCCAGATCTCTGTGTGGG - Intronic
982909764 4:161125115-161125137 TATATCCTAGAAATGTGTGAAGG - Intergenic
983153927 4:164320778-164320800 AATGTGATAGAAATGTGTGTGGG + Intronic
984966485 4:185144238-185144260 TATCTGCTTGAAAACTTTGGAGG + Intronic
985761762 5:1752597-1752619 TACGTGGTAGAAATGTGTGTGGG - Intergenic
987334901 5:16890124-16890146 TATGTGATAGAAATCTGCAAAGG - Intronic
990900978 5:60748595-60748617 TATCTGCTAGAAACATCTGGAGG + Intergenic
990982321 5:61613211-61613233 TAAGTGCTAGAACACTGTGCTGG + Intergenic
995207106 5:109492971-109492993 TATGTGCCAAAATACTGTGGTGG + Intergenic
995482588 5:112608016-112608038 TAGGTGGTTGAAATCAGTGGTGG + Intergenic
999635547 5:153618139-153618161 GATGGGCTAGAAATCTTTGTGGG + Intronic
999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG + Exonic
1001398018 5:171430425-171430447 TCTGTGCTAGGAATCTCTTGAGG - Intronic
1007168552 6:39846242-39846264 TAGGTGCTAAAAATCAATGGTGG + Intronic
1008478839 6:51962957-51962979 TATGTGCTAGACATCTTTTAGGG - Intronic
1010139500 6:72597929-72597951 TATGTGCTAAAAAAGTGGGGAGG - Intergenic
1010214740 6:73391605-73391627 TATGTGGTCGGAATCAGTGGTGG - Intronic
1010424786 6:75716649-75716671 TATGTGCTATAAATCTGTCATGG - Exonic
1010857230 6:80854873-80854895 TATTTGCTAGTAATTTGTTGAGG - Intergenic
1011608942 6:89131672-89131694 TACTTGGTAGAACTCTGTGGTGG + Intergenic
1011878019 6:91986335-91986357 TATATTCTAGATATTTGTGGAGG + Intergenic
1012586769 6:100932983-100933005 TATGTGCTATAACTCTGGTGGGG - Intergenic
1012737552 6:102969299-102969321 AATTTTCTAGAAAACTGTGGAGG - Intergenic
1013985902 6:116193365-116193387 CGTGTGTTAGAAAGCTGTGGTGG + Intronic
1014220565 6:118794962-118794984 AAAGTGCTAGAGATGTGTGGAGG - Intergenic
1015201493 6:130586438-130586460 TATGTTCCAGAAATTTGTTGTGG - Intergenic
1015941960 6:138461754-138461776 AATGTGGTAGAAATTTGAGGGGG + Intronic
1016373403 6:143396961-143396983 TTTGTGCTAGAATTCTTTAGTGG + Intergenic
1017345687 6:153377824-153377846 TATGTGCTAGGTCTCTGTGTGGG - Intergenic
1017822087 6:158056894-158056916 TATGTGCTCCATATCTGAGGAGG + Intronic
1019484826 7:1284702-1284724 GATGAGCTAGAAAGCTGGGGAGG + Intergenic
1028565481 7:92225822-92225844 TATATGCTAGAAATGTGGGTGGG + Exonic
1028835663 7:95372226-95372248 CAAGCGCTAGAAATCAGTGGTGG - Exonic
1029845952 7:103412513-103412535 TAAGTTCTAGAAATCTTGGGAGG + Intronic
1030108742 7:106008762-106008784 TCTGTGCTAGAACTCTTGGGTGG + Intronic
1030333753 7:108301398-108301420 GTTGTCCTAGAAATCTGTGTAGG - Intronic
1030635351 7:111942086-111942108 AATGTGCTAGAAATCTGATCGGG - Intronic
1031141359 7:117947038-117947060 TAGGTCCTTGAAATCTGTGTAGG - Intergenic
1037339579 8:17830074-17830096 TATGTGTTGAAAATCTATGGTGG + Intergenic
1040726655 8:50388883-50388905 TAAGTGCTTGATATTTGTGGTGG - Intronic
1043044031 8:75298430-75298452 GAGGTGCTAGAAAACTCTGGAGG + Intergenic
1044407968 8:91851998-91852020 AATGTTCTAGAATTATGTGGAGG - Intergenic
1045674607 8:104593375-104593397 TATGAGCTAGAAATGTATGTAGG + Intronic
1046054145 8:109059430-109059452 TATGTGGTAAAAATCTGTAGAGG - Intergenic
1046142925 8:110119399-110119421 TATATGCTGGAAATCTATAGGGG + Intergenic
1046848615 8:118947469-118947491 GAAGTTCTAGGAATCTGTGGGGG + Intronic
1047083490 8:121491293-121491315 TGTGTGCTAGAGAACAGTGGCGG - Intergenic
1047714263 8:127581304-127581326 TACTTGCTGGAAATTTGTGGTGG - Intergenic
1048087844 8:131203285-131203307 TATGTACAAGAAATGTTTGGTGG - Intergenic
1048604105 8:135949667-135949689 TAGGTGCTAGCACTCTGTGCTGG + Intergenic
1051929294 9:22365931-22365953 TATGTGCTAGAAATAAGTTGTGG - Intergenic
1052915536 9:33922300-33922322 AATGTGATAGAAGTCTGGGGGGG - Exonic
1054785427 9:69205489-69205511 CATGTGCTAGGAATCTGTAATGG + Intronic
1055393123 9:75844610-75844632 TAGGTCCTAGATATCTCTGGGGG + Intergenic
1057866882 9:98688447-98688469 CATCTGCAAGTAATCTGTGGTGG - Intronic
1188234852 X:27715401-27715423 TCTATTCTTGAAATCTGTGGTGG + Intronic
1189905234 X:45752409-45752431 TCTGTGCTACAAACCTGTGATGG - Intergenic
1192790396 X:74376722-74376744 TATGTGGTCCAAATCAGTGGTGG - Intergenic
1192816411 X:74598140-74598162 TATGTGCTACAAATTTGTGTGGG - Intronic
1196342686 X:114614143-114614165 TATTTACTATAAATCTGCGGTGG - Intronic
1196687636 X:118525788-118525810 TTTGTGCTAGAAAACTCTGGGGG + Intronic
1197965860 X:132060914-132060936 TTTGTTCTGGAAATCAGTGGTGG - Intergenic
1197978667 X:132193703-132193725 TATGAACAAGAAATCTTTGGGGG + Intergenic
1198562034 X:137860805-137860827 TATGTGCCAGGAATCTGAGTAGG + Intergenic
1201786707 Y:17791054-17791076 TATCTGCTTGAAATCTATGATGG + Intergenic
1201814846 Y:18114934-18114956 TATCTGCTTGAAATCTATGATGG - Intergenic