ID: 999806397

View in Genome Browser
Species Human (GRCh38)
Location 5:155085441-155085463
Sequence CATTTCTAGCAGCTTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999806397_999806400 -9 Left 999806397 5:155085441-155085463 CCACCCAGAAGCTGCTAGAAATG No data
Right 999806400 5:155085455-155085477 CTAGAAATGATTTATTCATGAGG No data
999806397_999806402 2 Left 999806397 5:155085441-155085463 CCACCCAGAAGCTGCTAGAAATG No data
Right 999806402 5:155085466-155085488 TTATTCATGAGGCTGAGTCAGGG No data
999806397_999806401 1 Left 999806397 5:155085441-155085463 CCACCCAGAAGCTGCTAGAAATG No data
Right 999806401 5:155085465-155085487 TTTATTCATGAGGCTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999806397 Original CRISPR CATTTCTAGCAGCTTCTGGG TGG (reversed) Intergenic
No off target data available for this crispr