ID: 999807244

View in Genome Browser
Species Human (GRCh38)
Location 5:155093653-155093675
Sequence CAGCTACTCCCTTGTTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999807244_999807249 11 Left 999807244 5:155093653-155093675 CCAGAATAACAAGGGAGTAGCTG No data
Right 999807249 5:155093687-155093709 GATCTTTGCCTCTAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999807244 Original CRISPR CAGCTACTCCCTTGTTATTC TGG (reversed) Intergenic
No off target data available for this crispr