ID: 999807799

View in Genome Browser
Species Human (GRCh38)
Location 5:155100001-155100023
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999807797_999807799 8 Left 999807797 5:155099970-155099992 CCTTATAGAGATGGTGCGTTCTT No data
Right 999807799 5:155100001-155100023 CTGCATAATATTTCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr