ID: 999809364

View in Genome Browser
Species Human (GRCh38)
Location 5:155113358-155113380
Sequence TCCCAAATGCTACTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999809358_999809364 15 Left 999809358 5:155113320-155113342 CCAAGTTGGATGACCTCCATCAA No data
Right 999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG No data
999809361_999809364 2 Left 999809361 5:155113333-155113355 CCTCCATCAAACAAGATGGGCAA No data
Right 999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG No data
999809362_999809364 -1 Left 999809362 5:155113336-155113358 CCATCAAACAAGATGGGCAAATT No data
Right 999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG No data
999809357_999809364 18 Left 999809357 5:155113317-155113339 CCTCCAAGTTGGATGACCTCCAT No data
Right 999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999809364 Original CRISPR TCCCAAATGCTACTGGTCAC AGG Intergenic
No off target data available for this crispr