ID: 999809481

View in Genome Browser
Species Human (GRCh38)
Location 5:155114595-155114617
Sequence TTCTTTGCACTGGTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999809481_999809490 7 Left 999809481 5:155114595-155114617 CCATCCTCAACCAGTGCAAAGAA No data
Right 999809490 5:155114625-155114647 TTAGGAATTGGGTCTGGTCTTGG No data
999809481_999809491 28 Left 999809481 5:155114595-155114617 CCATCCTCAACCAGTGCAAAGAA No data
Right 999809491 5:155114646-155114668 GGTTTAGCCATAGCATTGAGAGG No data
999809481_999809485 -5 Left 999809481 5:155114595-155114617 CCATCCTCAACCAGTGCAAAGAA No data
Right 999809485 5:155114613-155114635 AAGAACCCAAGATTAGGAATTGG No data
999809481_999809489 1 Left 999809481 5:155114595-155114617 CCATCCTCAACCAGTGCAAAGAA No data
Right 999809489 5:155114619-155114641 CCAAGATTAGGAATTGGGTCTGG No data
999809481_999809486 -4 Left 999809481 5:155114595-155114617 CCATCCTCAACCAGTGCAAAGAA No data
Right 999809486 5:155114614-155114636 AGAACCCAAGATTAGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999809481 Original CRISPR TTCTTTGCACTGGTTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr