ID: 999816218

View in Genome Browser
Species Human (GRCh38)
Location 5:155178964-155178986
Sequence GTGTGGCTATGTAGGAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999816218_999816226 19 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816226 5:155179006-155179028 GGCAGCACCCTATAACTTACAGG No data
999816218_999816229 26 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816229 5:155179013-155179035 CCCTATAACTTACAGGGACTAGG No data
999816218_999816224 -3 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816224 5:155178984-155179006 CACTTTTAAATTGCTGGGGAAGG No data
999816218_999816222 -7 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816222 5:155178980-155179002 GCCACACTTTTAAATTGCTGGGG No data
999816218_999816225 -2 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816225 5:155178985-155179007 ACTTTTAAATTGCTGGGGAAGGG No data
999816218_999816220 -9 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816220 5:155178978-155179000 TAGCCACACTTTTAAATTGCTGG No data
999816218_999816227 20 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816227 5:155179007-155179029 GCAGCACCCTATAACTTACAGGG No data
999816218_999816221 -8 Left 999816218 5:155178964-155178986 CCATATTTCCTACATAGCCACAC No data
Right 999816221 5:155178979-155179001 AGCCACACTTTTAAATTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999816218 Original CRISPR GTGTGGCTATGTAGGAAATA TGG (reversed) Intergenic
No off target data available for this crispr