ID: 999816613

View in Genome Browser
Species Human (GRCh38)
Location 5:155183457-155183479
Sequence CTGTTATTCATAAGGACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999816611_999816613 28 Left 999816611 5:155183406-155183428 CCGTTAGTTTTTTCTCAAATTTC No data
Right 999816613 5:155183457-155183479 CTGTTATTCATAAGGACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999816613 Original CRISPR CTGTTATTCATAAGGACTAT TGG Intergenic
No off target data available for this crispr