ID: 999830228

View in Genome Browser
Species Human (GRCh38)
Location 5:155311881-155311903
Sequence CAGAGGAAACATATGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999830224_999830228 11 Left 999830224 5:155311847-155311869 CCTCTTTGTATACAGACATCGCT No data
Right 999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG No data
999830223_999830228 14 Left 999830223 5:155311844-155311866 CCTCCTCTTTGTATACAGACATC No data
Right 999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999830228 Original CRISPR CAGAGGAAACATATGAATGG TGG Intergenic
No off target data available for this crispr