ID: 999835275

View in Genome Browser
Species Human (GRCh38)
Location 5:155363755-155363777
Sequence ATGTTAACTCAGGTGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999835275_999835282 20 Left 999835275 5:155363755-155363777 CCATTTTCCACCTGAGTTAACAT No data
Right 999835282 5:155363798-155363820 TACTCTGAGCAGTGACAGAGAGG No data
999835275_999835283 21 Left 999835275 5:155363755-155363777 CCATTTTCCACCTGAGTTAACAT No data
Right 999835283 5:155363799-155363821 ACTCTGAGCAGTGACAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999835275 Original CRISPR ATGTTAACTCAGGTGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr