ID: 999840164

View in Genome Browser
Species Human (GRCh38)
Location 5:155416093-155416115
Sequence CACCTTGGATTTGGAGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999840164_999840172 23 Left 999840164 5:155416093-155416115 CCAAACTCTCCAAATCCAAGGTG No data
Right 999840172 5:155416139-155416161 GGCCGACATAAGCCAGGCTTTGG No data
999840164_999840169 2 Left 999840164 5:155416093-155416115 CCAAACTCTCCAAATCCAAGGTG No data
Right 999840169 5:155416118-155416140 TTGAGGCATTTAGCCATTGCTGG No data
999840164_999840171 17 Left 999840164 5:155416093-155416115 CCAAACTCTCCAAATCCAAGGTG No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999840164 Original CRISPR CACCTTGGATTTGGAGAGTT TGG (reversed) Intergenic
No off target data available for this crispr