ID: 999840166

View in Genome Browser
Species Human (GRCh38)
Location 5:155416102-155416124
Sequence GCCTCAAGGCACCTTGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999840166_999840172 14 Left 999840166 5:155416102-155416124 CCAAATCCAAGGTGCCTTGAGGC No data
Right 999840172 5:155416139-155416161 GGCCGACATAAGCCAGGCTTTGG No data
999840166_999840171 8 Left 999840166 5:155416102-155416124 CCAAATCCAAGGTGCCTTGAGGC No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data
999840166_999840175 28 Left 999840166 5:155416102-155416124 CCAAATCCAAGGTGCCTTGAGGC No data
Right 999840175 5:155416153-155416175 AGGCTTTGGTAAAAACAAATTGG No data
999840166_999840169 -7 Left 999840166 5:155416102-155416124 CCAAATCCAAGGTGCCTTGAGGC No data
Right 999840169 5:155416118-155416140 TTGAGGCATTTAGCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999840166 Original CRISPR GCCTCAAGGCACCTTGGATT TGG (reversed) Intergenic