ID: 999840167

View in Genome Browser
Species Human (GRCh38)
Location 5:155416108-155416130
Sequence CTAAATGCCTCAAGGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999840167_999840172 8 Left 999840167 5:155416108-155416130 CCAAGGTGCCTTGAGGCATTTAG No data
Right 999840172 5:155416139-155416161 GGCCGACATAAGCCAGGCTTTGG No data
999840167_999840171 2 Left 999840167 5:155416108-155416130 CCAAGGTGCCTTGAGGCATTTAG No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data
999840167_999840175 22 Left 999840167 5:155416108-155416130 CCAAGGTGCCTTGAGGCATTTAG No data
Right 999840175 5:155416153-155416175 AGGCTTTGGTAAAAACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999840167 Original CRISPR CTAAATGCCTCAAGGCACCT TGG (reversed) Intergenic
No off target data available for this crispr