ID: 999840168

View in Genome Browser
Species Human (GRCh38)
Location 5:155416116-155416138
Sequence AGCAATGGCTAAATGCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999840168_999840175 14 Left 999840168 5:155416116-155416138 CCTTGAGGCATTTAGCCATTGCT No data
Right 999840175 5:155416153-155416175 AGGCTTTGGTAAAAACAAATTGG No data
999840168_999840171 -6 Left 999840168 5:155416116-155416138 CCTTGAGGCATTTAGCCATTGCT No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data
999840168_999840176 30 Left 999840168 5:155416116-155416138 CCTTGAGGCATTTAGCCATTGCT No data
Right 999840176 5:155416169-155416191 AAATTGGACCTTTGAAGTTTTGG No data
999840168_999840172 0 Left 999840168 5:155416116-155416138 CCTTGAGGCATTTAGCCATTGCT No data
Right 999840172 5:155416139-155416161 GGCCGACATAAGCCAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999840168 Original CRISPR AGCAATGGCTAAATGCCTCA AGG (reversed) Intergenic
No off target data available for this crispr