ID: 999840169

View in Genome Browser
Species Human (GRCh38)
Location 5:155416118-155416140
Sequence TTGAGGCATTTAGCCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999840166_999840169 -7 Left 999840166 5:155416102-155416124 CCAAATCCAAGGTGCCTTGAGGC No data
Right 999840169 5:155416118-155416140 TTGAGGCATTTAGCCATTGCTGG No data
999840164_999840169 2 Left 999840164 5:155416093-155416115 CCAAACTCTCCAAATCCAAGGTG No data
Right 999840169 5:155416118-155416140 TTGAGGCATTTAGCCATTGCTGG No data
999840162_999840169 25 Left 999840162 5:155416070-155416092 CCAAACATGTGTGATTTTGGGCT No data
Right 999840169 5:155416118-155416140 TTGAGGCATTTAGCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999840169 Original CRISPR TTGAGGCATTTAGCCATTGC TGG Intergenic
No off target data available for this crispr