ID: 999840171

View in Genome Browser
Species Human (GRCh38)
Location 5:155416133-155416155
Sequence ATTGCTGGCCGACATAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999840168_999840171 -6 Left 999840168 5:155416116-155416138 CCTTGAGGCATTTAGCCATTGCT No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data
999840166_999840171 8 Left 999840166 5:155416102-155416124 CCAAATCCAAGGTGCCTTGAGGC No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data
999840164_999840171 17 Left 999840164 5:155416093-155416115 CCAAACTCTCCAAATCCAAGGTG No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data
999840167_999840171 2 Left 999840167 5:155416108-155416130 CCAAGGTGCCTTGAGGCATTTAG No data
Right 999840171 5:155416133-155416155 ATTGCTGGCCGACATAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999840171 Original CRISPR ATTGCTGGCCGACATAAGCC AGG Intergenic
No off target data available for this crispr