ID: 999840175

View in Genome Browser
Species Human (GRCh38)
Location 5:155416153-155416175
Sequence AGGCTTTGGTAAAAACAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999840168_999840175 14 Left 999840168 5:155416116-155416138 CCTTGAGGCATTTAGCCATTGCT No data
Right 999840175 5:155416153-155416175 AGGCTTTGGTAAAAACAAATTGG No data
999840166_999840175 28 Left 999840166 5:155416102-155416124 CCAAATCCAAGGTGCCTTGAGGC No data
Right 999840175 5:155416153-155416175 AGGCTTTGGTAAAAACAAATTGG No data
999840170_999840175 -1 Left 999840170 5:155416131-155416153 CCATTGCTGGCCGACATAAGCCA No data
Right 999840175 5:155416153-155416175 AGGCTTTGGTAAAAACAAATTGG No data
999840167_999840175 22 Left 999840167 5:155416108-155416130 CCAAGGTGCCTTGAGGCATTTAG No data
Right 999840175 5:155416153-155416175 AGGCTTTGGTAAAAACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999840175 Original CRISPR AGGCTTTGGTAAAAACAAAT TGG Intergenic
No off target data available for this crispr