ID: 999842844

View in Genome Browser
Species Human (GRCh38)
Location 5:155448014-155448036
Sequence TTCCCAGGAATCTTCCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999842844_999842849 -5 Left 999842844 5:155448014-155448036 CCCCTTTGGAAGATTCCTGGGAA No data
Right 999842849 5:155448032-155448054 GGGAAGCACTCTGAATGGTTAGG No data
999842844_999842847 -10 Left 999842844 5:155448014-155448036 CCCCTTTGGAAGATTCCTGGGAA No data
Right 999842847 5:155448027-155448049 TTCCTGGGAAGCACTCTGAATGG No data
999842844_999842850 14 Left 999842844 5:155448014-155448036 CCCCTTTGGAAGATTCCTGGGAA No data
Right 999842850 5:155448051-155448073 TAGGTTCACATATATAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999842844 Original CRISPR TTCCCAGGAATCTTCCAAAG GGG (reversed) Intergenic
No off target data available for this crispr