ID: 999843033

View in Genome Browser
Species Human (GRCh38)
Location 5:155449540-155449562
Sequence CCCTGTGGCAGGCTTTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999843022_999843033 30 Left 999843022 5:155449487-155449509 CCCACATTTACCTTGAACACTGC No data
Right 999843033 5:155449540-155449562 CCCTGTGGCAGGCTTTTGGCTGG No data
999843025_999843033 20 Left 999843025 5:155449497-155449519 CCTTGAACACTGCTCTAACGGAG No data
Right 999843033 5:155449540-155449562 CCCTGTGGCAGGCTTTTGGCTGG No data
999843023_999843033 29 Left 999843023 5:155449488-155449510 CCACATTTACCTTGAACACTGCT No data
Right 999843033 5:155449540-155449562 CCCTGTGGCAGGCTTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999843033 Original CRISPR CCCTGTGGCAGGCTTTTGGC TGG Intergenic
No off target data available for this crispr