ID: 999845849

View in Genome Browser
Species Human (GRCh38)
Location 5:155479376-155479398
Sequence CACAAGGCCGTTCCAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999845849_999845852 -5 Left 999845849 5:155479376-155479398 CCTTTCTCTGGAACGGCCTTGTG No data
Right 999845852 5:155479394-155479416 TTGTGACTGTGCTTATCCAAGGG No data
999845849_999845851 -6 Left 999845849 5:155479376-155479398 CCTTTCTCTGGAACGGCCTTGTG No data
Right 999845851 5:155479393-155479415 CTTGTGACTGTGCTTATCCAAGG No data
999845849_999845853 -4 Left 999845849 5:155479376-155479398 CCTTTCTCTGGAACGGCCTTGTG No data
Right 999845853 5:155479395-155479417 TGTGACTGTGCTTATCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999845849 Original CRISPR CACAAGGCCGTTCCAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr