ID: 999846614

View in Genome Browser
Species Human (GRCh38)
Location 5:155488388-155488410
Sequence CTGTATAATCACATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999846614_999846618 4 Left 999846614 5:155488388-155488410 CCTTCCACCATGTGATTATACAG No data
Right 999846618 5:155488415-155488437 AACATGGCCCTCTGTGAACTAGG No data
999846614_999846620 11 Left 999846614 5:155488388-155488410 CCTTCCACCATGTGATTATACAG No data
Right 999846620 5:155488422-155488444 CCCTCTGTGAACTAGGACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999846614 Original CRISPR CTGTATAATCACATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr