ID: 999850162

View in Genome Browser
Species Human (GRCh38)
Location 5:155529061-155529083
Sequence ATGTGCTTGTGTAAGTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999850158_999850162 30 Left 999850158 5:155529008-155529030 CCTGGCCATTTGTGGGGGGCGGG No data
Right 999850162 5:155529061-155529083 ATGTGCTTGTGTAAGTGTAGAGG No data
999850161_999850162 25 Left 999850161 5:155529013-155529035 CCATTTGTGGGGGGCGGGGTAAA No data
Right 999850162 5:155529061-155529083 ATGTGCTTGTGTAAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999850162 Original CRISPR ATGTGCTTGTGTAAGTGTAG AGG Intergenic
No off target data available for this crispr