ID: 999854450

View in Genome Browser
Species Human (GRCh38)
Location 5:155578973-155578995
Sequence ATGAATAAACAAATGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999854448_999854450 8 Left 999854448 5:155578942-155578964 CCTAGCGTCAGTTCTCAGAAATA No data
Right 999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999854450 Original CRISPR ATGAATAAACAAATGGTGAA TGG Intergenic
No off target data available for this crispr