ID: 999854893

View in Genome Browser
Species Human (GRCh38)
Location 5:155583529-155583551
Sequence GTAAACCAGGGGTCCCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999854893_999854898 2 Left 999854893 5:155583529-155583551 CCCAACTGGGACCCCTGGTTTAC No data
Right 999854898 5:155583554-155583576 AGCATCCTCAGACACATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999854893 Original CRISPR GTAAACCAGGGGTCCCAGTT GGG (reversed) Intergenic
No off target data available for this crispr