ID: 999859819

View in Genome Browser
Species Human (GRCh38)
Location 5:155633461-155633483
Sequence TGCCCACTCCACAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999859819_999859830 27 Left 999859819 5:155633461-155633483 CCTCCCACTTTGTGGAGTGGGCA No data
Right 999859830 5:155633511-155633533 CCCTCCTGAGTTTGTGGAACTGG No data
999859819_999859823 -4 Left 999859819 5:155633461-155633483 CCTCCCACTTTGTGGAGTGGGCA No data
Right 999859823 5:155633480-155633502 GGCAGGAGCCAGAGACAAGCAGG No data
999859819_999859826 21 Left 999859819 5:155633461-155633483 CCTCCCACTTTGTGGAGTGGGCA No data
Right 999859826 5:155633505-155633527 CCCTACCCCTCCTGAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999859819 Original CRISPR TGCCCACTCCACAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr