ID: 999861278 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:155649299-155649321 |
| Sequence | CCTCATCTGTAAAATGGGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2830 | |||
| Summary | {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 999861273_999861278 | 22 | Left | 999861273 | 5:155649254-155649276 | CCATGTGACTTTGGGCATTTATT | No data | ||
| Right | 999861278 | 5:155649299-155649321 | CCTCATCTGTAAAATGGGGATGG | 0: 15 1: 99 2: 349 3: 811 4: 1556 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 999861278 | Original CRISPR | CCTCATCTGTAAAATGGGGA TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||