ID: 999861278

View in Genome Browser
Species Human (GRCh38)
Location 5:155649299-155649321
Sequence CCTCATCTGTAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999861273_999861278 22 Left 999861273 5:155649254-155649276 CCATGTGACTTTGGGCATTTATT No data
Right 999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999861278 Original CRISPR CCTCATCTGTAAAATGGGGA TGG Intergenic
Too many off-targets to display for this crispr