ID: 999864375

View in Genome Browser
Species Human (GRCh38)
Location 5:155684685-155684707
Sequence TATCTTGTAGGAAGGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999864369_999864375 14 Left 999864369 5:155684648-155684670 CCCAAATAGGGCTCAGGGCTCAT No data
Right 999864375 5:155684685-155684707 TATCTTGTAGGAAGGACTGCAGG No data
999864368_999864375 15 Left 999864368 5:155684647-155684669 CCCCAAATAGGGCTCAGGGCTCA No data
Right 999864375 5:155684685-155684707 TATCTTGTAGGAAGGACTGCAGG No data
999864370_999864375 13 Left 999864370 5:155684649-155684671 CCAAATAGGGCTCAGGGCTCATG No data
Right 999864375 5:155684685-155684707 TATCTTGTAGGAAGGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999864375 Original CRISPR TATCTTGTAGGAAGGACTGC AGG Intergenic
No off target data available for this crispr