ID: 999865265

View in Genome Browser
Species Human (GRCh38)
Location 5:155694282-155694304
Sequence GAGTGTTTGGTCTACCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999865265_999865273 27 Left 999865265 5:155694282-155694304 CCCTGCTGGTAGACCAAACACTC No data
Right 999865273 5:155694332-155694354 TGAGGCCTTATAGGAAGATAAGG No data
999865265_999865268 -3 Left 999865265 5:155694282-155694304 CCCTGCTGGTAGACCAAACACTC No data
Right 999865268 5:155694302-155694324 CTCTGTGAGTCCTCATATAGTGG No data
999865265_999865271 9 Left 999865265 5:155694282-155694304 CCCTGCTGGTAGACCAAACACTC No data
Right 999865271 5:155694314-155694336 TCATATAGTGGCAGTGGTTGAGG No data
999865265_999865272 18 Left 999865265 5:155694282-155694304 CCCTGCTGGTAGACCAAACACTC No data
Right 999865272 5:155694323-155694345 GGCAGTGGTTGAGGCCTTATAGG No data
999865265_999865269 3 Left 999865265 5:155694282-155694304 CCCTGCTGGTAGACCAAACACTC No data
Right 999865269 5:155694308-155694330 GAGTCCTCATATAGTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999865265 Original CRISPR GAGTGTTTGGTCTACCAGCA GGG (reversed) Intergenic
No off target data available for this crispr