ID: 999875421

View in Genome Browser
Species Human (GRCh38)
Location 5:155800280-155800302
Sequence CACTGTGTTTTAGGAGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999875421_999875423 -4 Left 999875421 5:155800280-155800302 CCATATTCTCCTAAAACACAGTG No data
Right 999875423 5:155800299-155800321 AGTGTGTGCATATTTGTTTCTGG No data
999875421_999875424 1 Left 999875421 5:155800280-155800302 CCATATTCTCCTAAAACACAGTG No data
Right 999875424 5:155800304-155800326 GTGCATATTTGTTTCTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999875421 Original CRISPR CACTGTGTTTTAGGAGAATA TGG (reversed) Intergenic
No off target data available for this crispr