ID: 999878375

View in Genome Browser
Species Human (GRCh38)
Location 5:155833945-155833967
Sequence GTCCTTCCACAACTCAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999878375_999878379 21 Left 999878375 5:155833945-155833967 CCTACACTGAGTTGTGGAAGGAC No data
Right 999878379 5:155833989-155834011 GCTTAGTTTTGCTCATGGTGTGG No data
999878375_999878380 27 Left 999878375 5:155833945-155833967 CCTACACTGAGTTGTGGAAGGAC No data
Right 999878380 5:155833995-155834017 TTTTGCTCATGGTGTGGCTATGG No data
999878375_999878377 16 Left 999878375 5:155833945-155833967 CCTACACTGAGTTGTGGAAGGAC No data
Right 999878377 5:155833984-155834006 CACCTGCTTAGTTTTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999878375 Original CRISPR GTCCTTCCACAACTCAGTGT AGG (reversed) Intergenic
No off target data available for this crispr