ID: 999881838

View in Genome Browser
Species Human (GRCh38)
Location 5:155873203-155873225
Sequence GTGGCTAACTAAAGTCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999881838 Original CRISPR GTGGCTAACTAAAGTCATGC TGG (reversed) Intronic
902305880 1:15538896-15538918 GTGGCTAAATACAAACATGCTGG - Intronic
902876901 1:19345792-19345814 GTGGCTCACCCTAGTCATGCAGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
924951268 1:248885867-248885889 GTTGCTAAATAAACACATGCAGG + Intergenic
1064009985 10:11727923-11727945 GTGGCCAGCTAAAACCATGCAGG - Intergenic
1072954330 10:99875420-99875442 GAGGCTAACTGAAGAAATGCAGG - Intergenic
1078715807 11:13838089-13838111 GTGGCTAACAAAAATCATCTTGG - Intergenic
1084397766 11:68924856-68924878 TTGTCTAACTAAAGGCCTGCAGG + Intronic
1096429272 12:51529956-51529978 GTGGCTAAAATAAGTCATGTGGG + Intergenic
1104610052 12:130220318-130220340 GTGACTACATAAACTCATGCCGG + Intergenic
1107921617 13:45214441-45214463 GTGGCTAACTGGAGTCTTGCAGG - Intronic
1115115359 14:29874929-29874951 GTTGCTAACTATAGTCACCCTGG - Intronic
1121558024 14:94852895-94852917 GTGGCTAAGCAAAGTCCAGCTGG - Intergenic
1130734977 15:86538566-86538588 GAGGCTAACTAAAGCCCTGGAGG - Intronic
1138629074 16:58279214-58279236 GTTGCAAACTGAGGTCATGCAGG + Intronic
1140973705 16:80038850-80038872 GTGGCTAACCTGAGACATGCTGG - Intergenic
1148788623 17:50160404-50160426 GTGATTAAGTGAAGTCATGCTGG - Intergenic
1150719650 17:67603419-67603441 GTGGCTATCTAAAGACAGGTTGG - Intronic
1159733333 18:72060575-72060597 GTGGCTAACTGAAGTGCTACGGG + Intergenic
1166410874 19:42554760-42554782 GCTGCTCTCTAAAGTCATGCTGG + Intronic
927267762 2:21172255-21172277 GTGGATGACAAGAGTCATGCTGG - Intergenic
932514049 2:72326592-72326614 GAGGCTATCTAGAGTGATGCTGG + Intronic
933316056 2:80716763-80716785 GGGGCTGAGAAAAGTCATGCTGG + Intergenic
938746941 2:134288358-134288380 GTCTGTAAATAAAGTCATGCTGG + Intronic
938920652 2:135991540-135991562 TTGGCAAACTAGAGTCATTCAGG - Intergenic
938992977 2:136648165-136648187 GTGGTTAACTAAAGGCACACTGG - Intergenic
940118348 2:150235480-150235502 GTGACTCTCTAAAGTCATCCAGG - Intergenic
940812689 2:158263088-158263110 GAGGCAAGCTAAAGTCATGAAGG + Intronic
946663674 2:222027877-222027899 GAGGCTAAGCAATGTCATGCAGG + Intergenic
1170464271 20:16608704-16608726 GTGGCTAGAAAAAGTCATGAGGG + Intergenic
1182379713 22:29878059-29878081 GAGGCTTCCTAAAGTCATGCAGG - Intergenic
1183114256 22:35677701-35677723 TTGGGTTACAAAAGTCATGCGGG - Intergenic
950785007 3:15427316-15427338 GTGGCTGACTAAATTAACGCGGG - Intronic
951528846 3:23680035-23680057 GTGACTGACTAACGTCATGAAGG + Intergenic
957576728 3:82017107-82017129 ATGGATAAAAAAAGTCATGCAGG + Intergenic
962207526 3:133447236-133447258 GTGCCTAACACAAGTCATGGTGG + Intronic
965158008 3:165089377-165089399 TTGGCTCTCTAAAGTCATTCTGG - Intergenic
966410755 3:179643749-179643771 GTGGCAAACCAAAGGCCTGCGGG - Intergenic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
971454313 4:26829851-26829873 GTTGCTTACTAAAGTCATTCCGG - Intergenic
974689882 4:65283997-65284019 GTGGCTAAATAAAGTTATACTGG + Intergenic
979456153 4:120927961-120927983 GTGGCTAACCAAGGCCATGGTGG + Intergenic
984890220 4:184485416-184485438 CTTGCTAACTAAGGTGATGCTGG - Intergenic
990691231 5:58366685-58366707 GTGGCTCACTTAAGTCCAGCAGG + Intergenic
992357964 5:76005091-76005113 GGGGCTATTTAAAGTCCTGCTGG - Intergenic
995856741 5:116600715-116600737 GTGGCTCACTCAGGTCATGTAGG - Intergenic
996037618 5:118776045-118776067 GTAGCTACATAAAGTCATGATGG - Intergenic
997424559 5:133794391-133794413 GTGGCTGACCAAGGCCATGCTGG + Intergenic
999881838 5:155873203-155873225 GTGGCTAACTAAAGTCATGCTGG - Intronic
1008832318 6:55780718-55780740 CAGGATAACTAAAGTCATGCAGG + Intronic
1008881228 6:56382560-56382582 GTGGCTAAATGAAGTCATAAGGG + Intronic
1012454726 6:99391469-99391491 GTATCTACCTAAAGTCATACAGG - Intronic
1017083578 6:150692481-150692503 GTGGAAAACTAATGGCATGCTGG + Intronic
1029333208 7:99877765-99877787 GTGGCAGATCAAAGTCATGCTGG + Intronic
1032003197 7:128279785-128279807 GTGGCTGACTGATGTCATGTTGG + Intergenic
1032017824 7:128391165-128391187 TTGGTTTACAAAAGTCATGCAGG - Intergenic
1041795591 8:61744303-61744325 GAGGCAAAGTAAAGTCATACTGG - Intergenic
1048612188 8:136034975-136034997 ATGGCTTACTAAAGTGAGGCAGG + Intergenic
1055555760 9:77471726-77471748 GTCACTCACTACAGTCATGCAGG + Intronic
1056737798 9:89224634-89224656 TTGGCTAACTAGAGTCAAGATGG - Intergenic
1056993585 9:91433499-91433521 GTGGCTAACTGACATCATTCTGG + Intergenic
1059859481 9:118442925-118442947 GTAGCTGACTCCAGTCATGCTGG + Intergenic
1189777924 X:44486848-44486870 GTCACTAACTATAGTCATCCTGG - Intergenic
1195507651 X:105676531-105676553 GGGGCTAACTAAAATAATGTAGG + Intronic
1197219944 X:123902475-123902497 GGGGCTAACTGAAGTGAAGCAGG + Intronic
1198850347 X:140959861-140959883 ATGGCTAAGTAAATTCATCCAGG - Intergenic