ID: 999885130

View in Genome Browser
Species Human (GRCh38)
Location 5:155914078-155914100
Sequence ATAAGCAACTTGCCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999885123_999885130 21 Left 999885123 5:155914034-155914056 CCAATGCCCTTATTTTATAAATG 0: 1
1: 1
2: 5
3: 85
4: 574
Right 999885130 5:155914078-155914100 ATAAGCAACTTGCCCAAATTTGG 0: 1
1: 0
2: 0
3: 15
4: 172
999885125_999885130 14 Left 999885125 5:155914041-155914063 CCTTATTTTATAAATGAGAAAAC 0: 4
1: 69
2: 560
3: 2502
4: 7598
Right 999885130 5:155914078-155914100 ATAAGCAACTTGCCCAAATTTGG 0: 1
1: 0
2: 0
3: 15
4: 172
999885124_999885130 15 Left 999885124 5:155914040-155914062 CCCTTATTTTATAAATGAGAAAA 0: 3
1: 23
2: 171
3: 858
4: 3385
Right 999885130 5:155914078-155914100 ATAAGCAACTTGCCCAAATTTGG 0: 1
1: 0
2: 0
3: 15
4: 172
999885128_999885130 -8 Left 999885128 5:155914063-155914085 CCGAGGTCCAAGGACATAAGCAA 0: 1
1: 1
2: 0
3: 11
4: 138
Right 999885130 5:155914078-155914100 ATAAGCAACTTGCCCAAATTTGG 0: 1
1: 0
2: 0
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999885130 Original CRISPR ATAAGCAACTTGCCCAAATT TGG Intronic
906268875 1:44458425-44458447 CTAAGCAACTTACCCAAGTTAGG - Intronic
906840338 1:49131526-49131548 AGAAGCAGCTAACCCAAATTAGG + Intronic
908643120 1:66247142-66247164 ATGAGTAACTTGGACAAATTCGG - Intronic
909207892 1:72783227-72783249 ATATGAAACTTGTCAAAATTTGG + Intergenic
910555392 1:88526475-88526497 ATAACTTAATTGCCCAAATTTGG - Intergenic
911325689 1:96469070-96469092 ATAAATAACTCCCCCAAATTAGG - Intergenic
914347483 1:146812467-146812489 AGATGGAACTTTCCCAAATTTGG + Intergenic
915121484 1:153632107-153632129 ATAAGACACTTCCCCAAATAAGG - Exonic
917342598 1:173995065-173995087 AGAGGCAACCTGACCAAATTAGG + Intronic
917652011 1:177087335-177087357 ATTAGAAACTTGCCTAAATGTGG + Intronic
918053477 1:180996261-180996283 ATAAGCAGCAAGCCCAAATAAGG + Intronic
918643512 1:186874028-186874050 ATAAGTAGCTTGCACTAATTTGG + Intronic
918960806 1:191274797-191274819 TTCTGCAACTTGGCCAAATTGGG - Intergenic
918982350 1:191579313-191579335 ATACGCAGCATGTCCAAATTTGG - Intergenic
919086045 1:192921075-192921097 ATAAGCAATTTGTCCAAACTAGG + Intergenic
921424091 1:214982506-214982528 ATAACCAAGTTGCACAGATTGGG - Intergenic
923512446 1:234664167-234664189 CTAAGCCACTGGCCCACATTTGG + Intergenic
1063490568 10:6459834-6459856 ATAAGAAATTACCCCAAATTTGG - Intronic
1063553235 10:7053164-7053186 ATAATCAAATTTCCCCAATTAGG - Intergenic
1063950135 10:11214432-11214454 ATTAGCAACTTACACAAATGTGG - Intronic
1068458036 10:57285563-57285585 ATAAGCCACATGGCCAATTTTGG - Intergenic
1070259385 10:74839581-74839603 AAAAGCAACTTGGCAATATTGGG + Intronic
1071340898 10:84647504-84647526 ATAAGCAACTTCAGCAAAGTCGG - Intergenic
1072845483 10:98825650-98825672 ATAATCAACTTACACCAATTAGG - Intronic
1074684928 10:115952458-115952480 AAATGCAAATTCCCCAAATTGGG + Intergenic
1078350576 11:10589823-10589845 ATAAGCAGCAGCCCCAAATTAGG - Intronic
1085163030 11:74366608-74366630 ATAAGCAAGTTGGCAAGATTTGG + Intronic
1087778976 11:102283396-102283418 TTAAGTAATTTGCCCAAGTTAGG - Intergenic
1088095248 11:106092248-106092270 ATAAACAACTAGCCCAAGCTAGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093365689 12:18294324-18294346 ATGAGCAACTTGTCCTAGTTTGG - Intronic
1095373747 12:41501556-41501578 ATAAGCAACTTGCGAATGTTAGG - Intronic
1096746021 12:53727381-53727403 GTAAGAAACTTGGCCTAATTGGG - Intronic
1097662703 12:62447934-62447956 ATAAGTAATTTGCCCAACTAAGG - Intergenic
1098113067 12:67144561-67144583 ATGATCAATTTACCCAAATTTGG - Intergenic
1100102005 12:91120536-91120558 ATAAGCAACTGGACCTCATTGGG - Intergenic
1100247745 12:92780522-92780544 GTAAGTAATTTGCCCAAGTTAGG - Intronic
1101223371 12:102663362-102663384 ATAAGCTAGTTTCCCAAATGAGG + Intergenic
1106240909 13:27912593-27912615 ATAAGCATCTTGTCCATATAGGG + Intergenic
1106898916 13:34334436-34334458 ATAAACAACTGCCCCAAACTAGG + Intergenic
1106975449 13:35206556-35206578 AAAAGGAACTTGCCAATATTTGG - Intronic
1108065817 13:46576797-46576819 ATAAGAAATTGCCCCAAATTTGG + Intronic
1109707639 13:66118294-66118316 ATAAGCAACTTGCGTACATGTGG - Intergenic
1110142983 13:72154263-72154285 ATAAAGAACTTCCCCAAACTGGG + Intergenic
1110154462 13:72297648-72297670 ATAAGCAACTTCCAAAAATTGGG + Intergenic
1110928166 13:81182046-81182068 AAAAGCAACTTGCCAAGATGAGG + Intergenic
1111526903 13:89483660-89483682 ATAAGAAATTTCCACAAATTTGG - Intergenic
1112910559 13:104478031-104478053 TTAAGCAACACGCCAAAATTAGG - Intergenic
1115098649 14:29671212-29671234 AATAGCAAGTTGCCCTAATTAGG + Intronic
1118545482 14:66883107-66883129 AAAAGGAAATTTCCCAAATTTGG - Intronic
1118582103 14:67311536-67311558 ACATGCAACTTGCCCAGGTTAGG + Intronic
1121010110 14:90515032-90515054 ATAACCAACTTGCCCATGCTGGG - Intergenic
1124861644 15:33447920-33447942 TTAAGTAATTTGCCCAAGTTGGG + Intronic
1125187124 15:36943914-36943936 CTTAGCTGCTTGCCCAAATTTGG + Intronic
1125962513 15:43844023-43844045 AAGTCCAACTTGCCCAAATTTGG - Exonic
1126107173 15:45154214-45154236 AGAAGGAACTAGCCCAAAGTAGG - Intronic
1126338664 15:47615336-47615358 ATAAGCAACTTGCGCATCTGTGG + Intronic
1132762248 16:1515143-1515165 AAGAGCAAATTTCCCAAATTTGG + Intronic
1135056723 16:19238198-19238220 ATAAGTAACTTGGCCAAGATAGG - Intronic
1135090440 16:19510075-19510097 ATACTCAAGTTGCCCAAATGGGG + Intronic
1137957099 16:52842744-52842766 TCAAGCAACTTGCCCAAACTAGG + Intergenic
1138159898 16:54743798-54743820 CTAAGCAACTTGTCCAGGTTAGG + Intergenic
1139986503 16:70902763-70902785 AGATGGAACTTTCCCAAATTTGG - Intronic
1140259090 16:73361920-73361942 AAAATCAACTTGCCCCAATCAGG + Intergenic
1143234362 17:5385903-5385925 ATAACTAACTTGCTCAAATATGG + Intronic
1143617697 17:8063804-8063826 ATAAGCAACTTCCACAATTCTGG - Intergenic
1146205462 17:30901378-30901400 CTCAGCACCTTGCCCAAAGTAGG + Intronic
1146733997 17:35221663-35221685 CTAAGAAACTTGCACAAAGTAGG - Intergenic
1147349597 17:39830175-39830197 GAAAGCATCTTTCCCAAATTAGG - Intronic
1147695772 17:42351702-42351724 ATAAGGTATTTGCCCCAATTAGG + Intronic
1148897013 17:50844712-50844734 ATAAGAAACTTGCCCCAAATCGG + Intergenic
1149004638 17:51792936-51792958 GTAAGCAACTTGCCCAAGGTTGG + Intronic
1150465384 17:65388318-65388340 ATAAGAAGCTTGCACAAAATTGG - Intergenic
1151818138 17:76481633-76481655 AGAACCAACTTGCCTAAAGTTGG + Intronic
1152649534 17:81485711-81485733 AAATGTAACTTGCCCAAACTAGG - Intergenic
1153173929 18:2349681-2349703 TTAAGTAATTTGCACAAATTTGG - Intergenic
1155016833 18:21851037-21851059 ATAAGCAACTCTGCCATATTGGG + Intronic
1156790120 18:40962318-40962340 AAAAGAAAATCGCCCAAATTAGG - Intergenic
1157884543 18:51353909-51353931 ACAAGTCACTTGCCCAAATTTGG - Intergenic
1158182489 18:54732828-54732850 ACAAGCAACTTCACCAAATCTGG + Intronic
1158507287 18:58057924-58057946 ATGAGCAACTTCCCCACACTGGG + Intronic
1158682403 18:59580642-59580664 TAAAGCGACTTGCCCAAAGTAGG + Intronic
1158751395 18:60265463-60265485 ATAAGTAAGTTGCCCAAAGTTGG + Intergenic
1159090548 18:63843861-63843883 ATGCACAAATTGCCCAAATTTGG + Intergenic
1160119831 18:76120488-76120510 GTATGCAATTTGCCCAAAGTAGG + Intergenic
1165566275 19:36730906-36730928 ATAAGCAACATGCCTAAAGAGGG + Intronic
1167588114 19:50386489-50386511 GTCAGCATCTTGCCCAAGTTGGG - Intronic
926475603 2:13318044-13318066 ATAAGGAACTGCCCCAAACTGGG - Intergenic
926821207 2:16853616-16853638 CTAATAAACATGCCCAAATTAGG - Intergenic
927736929 2:25532582-25532604 GTAAGCAACATGCCACAATTAGG + Intronic
928534135 2:32223175-32223197 ATAAGGAACTTGCCCAGCATAGG + Intronic
929463778 2:42126553-42126575 ATAATCAAATTCCCCACATTAGG + Intergenic
937459194 2:122070779-122070801 AAAGGCAACTTGCCCAACTAAGG - Intergenic
939881570 2:147637235-147637257 TTAAGTAACTTGCCCATAATAGG - Intergenic
940011573 2:149060269-149060291 TTAAGTAACTTGCCCACAGTTGG - Intronic
941031996 2:160522924-160522946 TTAAGTTACTTGCCCAAGTTTGG - Intergenic
943662310 2:190572018-190572040 ATGATGAAATTGCCCAAATTGGG + Intergenic
945058983 2:205892079-205892101 TTGAGCAAGTTGCCAAAATTGGG - Intergenic
946340652 2:219065536-219065558 GTAAGCAACTCCACCAAATTTGG + Intergenic
1171154642 20:22860847-22860869 TTAAGAGACTTGCCCAGATTGGG + Intergenic
1172467389 20:35166365-35166387 TTAAGCAACCTGGCCCAATTTGG - Intergenic
1172758643 20:37306321-37306343 ATAAGCAAGTTGCAAAAAATCGG - Intronic
1172979846 20:38932698-38932720 ATAAGCACATTGCCAAAATGAGG - Intronic
1174167192 20:48593401-48593423 ATTAGGAAGTTTCCCAAATTTGG + Intergenic
1177335411 21:19718944-19718966 ACAAGCTACATTCCCAAATTGGG - Intergenic
1178479471 21:32967195-32967217 ATGAGCAACTTCCCCAGATCTGG + Intergenic
1182810106 22:33108912-33108934 TTAAGCTACTTGCCTAAATGTGG - Intergenic
950175722 3:10872937-10872959 ATCAGCAACTTGTCAACATTTGG - Intronic
952244754 3:31575182-31575204 ATAAGTAACTTGCCCAACCAAGG + Intronic
952420466 3:33126274-33126296 ATAACCAACTTGCCACAATATGG - Intronic
953190506 3:40682286-40682308 GTAAGAAACTTGCCCAAGTAAGG - Intergenic
956424318 3:69117808-69117830 ACAAACAACTGGCCCAATTTGGG + Intronic
957339382 3:78873923-78873945 TCAAGCAACTTGTCTAAATTTGG + Intronic
957557657 3:81781830-81781852 ATAAACAACTGCCCCAAACTGGG + Intergenic
959712297 3:109397273-109397295 ATAAGAAACCTGCCTATATTGGG + Intergenic
963393281 3:144697265-144697287 ATAAGGAACTTGAACAAATATGG - Intergenic
964720098 3:159762541-159762563 ATTAGCAACAGGCCCAAATCTGG + Intronic
970477593 4:16439417-16439439 ATAAGCCATTTTCCCAACTTGGG - Intergenic
971812227 4:31440931-31440953 ACAGGCAACTTGGCCAAAATTGG + Intergenic
972235395 4:37127145-37127167 ATTAGCAGCATCCCCAAATTTGG - Intergenic
972865076 4:43221946-43221968 ATCAGCAGCTTTCACAAATTGGG - Intergenic
973951239 4:56016313-56016335 ATAACCAACTACCACAAATTAGG - Intronic
975649742 4:76580724-76580746 ATTAAAAACTTGCCCAAAGTTGG - Intronic
976099824 4:81549903-81549925 ATCTGCACCTCGCCCAAATTGGG - Intronic
976895836 4:90110007-90110029 TTAAGTAACTTACCCAAAGTTGG + Intergenic
982071819 4:151702180-151702202 ATAAGCAAATTGCTCTCATTTGG - Intronic
983082820 4:163408658-163408680 ATAACCAAGTTCCCCAAATTAGG - Intergenic
983187613 4:164718439-164718461 ATAAGCCACATGCCCAGCTTGGG + Intergenic
983784173 4:171711450-171711472 ATTAGCAATTTGCCTAAATTGGG + Intergenic
984259660 4:177429425-177429447 AAAAGCAACTTGCCAGAATGGGG + Intergenic
984743565 4:183191341-183191363 TTAAGCAATGTGCCCAAATATGG - Intronic
986534208 5:8769590-8769612 ATAAGCAACTTGCCTATTTCTGG + Intergenic
986975924 5:13393784-13393806 ATAAGCAACTTGCAAAAATGAGG - Intergenic
988857233 5:35239983-35240005 ATATGCAACTTGACAAAATAGGG - Intergenic
994938185 5:106284003-106284025 ATAAGCTACTGGCTGAAATTTGG - Intergenic
995642272 5:114270649-114270671 ATCACCAACTTGCCCATAATGGG - Intergenic
997010434 5:129870797-129870819 ATAAGGAACTTAAACAAATTTGG + Intergenic
999885130 5:155914078-155914100 ATAAGCAACTTGCCCAAATTTGG + Intronic
1000913375 5:167049700-167049722 ATAAGCAACCTTGCTAAATTAGG - Intergenic
1007007786 6:38383156-38383178 ATAATCATCATGACCAAATTAGG + Intronic
1010595190 6:77754654-77754676 ATAAAGAACTTCCCCAAACTGGG + Intronic
1011264949 6:85506632-85506654 ATAAGTAAATAGCCCAAATCTGG + Intronic
1015563434 6:134540867-134540889 ATAATAAACTGGCCCAGATTGGG - Intergenic
1015615574 6:135071020-135071042 ATAAGCAATATGTTCAAATTTGG + Intronic
1016497346 6:144678987-144679009 ATAAGGAACTTGCCAAGTTTTGG + Intronic
1016819739 6:148336078-148336100 ATAAACAACTGGCCCAATATAGG + Intronic
1019675756 7:2311594-2311616 GTAAGTAATTTGCCCAAAGTGGG - Intronic
1019818344 7:3218030-3218052 TTAAGAAACTTGCCCAAAGTTGG - Intergenic
1021055356 7:16040894-16040916 ATCACCACCTTGCCAAAATTTGG - Intergenic
1026714689 7:72778162-72778184 ATAAACAACTTGCTAAAGTTAGG - Intronic
1027862782 7:83606296-83606318 TTTAGCAACTTGCCCATTTTTGG + Intronic
1028224955 7:88239531-88239553 TAAAGCAATTTGCCCATATTTGG + Intergenic
1029499183 7:100917340-100917362 ATAAGCAAGTTTCCCAAGTAAGG + Intergenic
1029901921 7:104050191-104050213 AAAAGCAATTGGCTCAAATTAGG - Intergenic
1030180371 7:106701434-106701456 AAATACAACTTACCCAAATTTGG - Intergenic
1031437032 7:121745064-121745086 TTAAGGAACTTGGCCAAGTTTGG - Intergenic
1033101178 7:138473786-138473808 ACAATCAAATTGCCCAAATTTGG + Intronic
1033445870 7:141421582-141421604 ATAAGGAACTTGCCCCAAGCAGG - Intronic
1037346736 8:17909119-17909141 ATAAGCAACTTCCACAATTCTGG + Intronic
1038848581 8:31252630-31252652 AAAAGCAACTTGCCTAATTAAGG - Intergenic
1041605415 8:59777526-59777548 AAAAGCAACTTCACCAAAGTAGG + Intergenic
1041776122 8:61524940-61524962 ATTAGCATATTGCCCAAATATGG + Intronic
1042243795 8:66691008-66691030 TTAAGTAACTTGCCCAAATCAGG + Intronic
1044424084 8:92031220-92031242 ATAAGCATCTTGCACATAGTAGG + Intronic
1045182468 8:99799424-99799446 AAAACCAACTTGCACAACTTTGG + Intronic
1046934228 8:119871006-119871028 ATAAGGAGCTTGCCCAAACATGG + Intergenic
1047861506 8:128972243-128972265 ATAAGGGACTTGGCCAAACTTGG + Intergenic
1048019425 8:130524855-130524877 ATAAGCAACTTGCCCGCTGTGGG - Intergenic
1051327213 9:15985573-15985595 TTAAGTGACTTTCCCAAATTAGG + Intronic
1052331783 9:27277690-27277712 AGAAGCAAATTAGCCAAATTTGG - Intergenic
1054753647 9:68934386-68934408 AGAAGTAACTTGGCTAAATTGGG + Intronic
1058194931 9:101961045-101961067 AAAAGCACATTGCACAAATTGGG + Intergenic
1058582693 9:106476062-106476084 GTAAGCAACTTATCCAAGTTAGG - Intergenic
1060067367 9:120514405-120514427 ATAAGCATGTGACCCAAATTGGG + Intronic
1186022937 X:5276640-5276662 ATAATAAACTTTCCCAAACTTGG - Intergenic
1186895544 X:14001433-14001455 ATAATCAATTTGTCCAAGTTAGG + Intergenic
1188684234 X:33049610-33049632 ATACTAAACTTGCCTAAATTAGG + Intronic
1188787324 X:34364030-34364052 ACAAACAGCTTGACCAAATTTGG + Intergenic
1188905293 X:35784233-35784255 ATAACCAACTTACACAAAATTGG - Intergenic
1189188608 X:39075574-39075596 ATAAGAAATTTTCACAAATTGGG - Intergenic
1191736060 X:64389038-64389060 TTAAGCAACTTGCCCAGAGCTGG - Intronic
1191991955 X:67047694-67047716 ACAAGCAACTTACCAGAATTGGG + Intergenic
1194220648 X:91185272-91185294 AAAAACAACTAGCCCAAAGTTGG + Intergenic
1194757639 X:97756215-97756237 AAAAGTGACTTGCCCAAATTGGG + Intergenic
1196652081 X:118178350-118178372 TTAAGCAACTTGCCCTAGCTAGG + Intergenic
1198176101 X:134156511-134156533 ATGAGAAACTTGGCAAAATTAGG + Intergenic
1200557157 Y:4649024-4649046 AAAAACAACTAGCCCAAAGTTGG + Intergenic
1201607467 Y:15803051-15803073 ATAATTAACTTGCCCAGATGTGG + Intergenic