ID: 999888523

View in Genome Browser
Species Human (GRCh38)
Location 5:155950935-155950957
Sequence TTTAGGAATTGCATGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999888515_999888523 28 Left 999888515 5:155950884-155950906 CCTCCTTTAAAGAATCCTTACCT 0: 1
1: 0
2: 2
3: 13
4: 183
Right 999888523 5:155950935-155950957 TTTAGGAATTGCATGTGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 174
999888518_999888523 13 Left 999888518 5:155950899-155950921 CCTTACCTGGTTTTAAAAGCATG 0: 1
1: 1
2: 3
3: 18
4: 196
Right 999888523 5:155950935-155950957 TTTAGGAATTGCATGTGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 174
999888517_999888523 25 Left 999888517 5:155950887-155950909 CCTTTAAAGAATCCTTACCTGGT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 999888523 5:155950935-155950957 TTTAGGAATTGCATGTGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 174
999888519_999888523 8 Left 999888519 5:155950904-155950926 CCTGGTTTTAAAAGCATGTTTTG 0: 1
1: 0
2: 4
3: 32
4: 364
Right 999888523 5:155950935-155950957 TTTAGGAATTGCATGTGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999888523 Original CRISPR TTTAGGAATTGCATGTGAGC TGG Intronic
901116095 1:6845669-6845691 TTTAGTAATTGCTTCTTAGCAGG + Intronic
903779791 1:25813980-25814002 TGGAGGAACTGCAGGTGAGCGGG + Exonic
905715384 1:40145157-40145179 TTTAGGAATAGCAGGTGATAAGG + Intergenic
907291416 1:53415304-53415326 TGGAGGAGTTTCATGTGAGCAGG - Intergenic
908475925 1:64488365-64488387 TATAGGACTTGCATGTAACCTGG + Intronic
912957639 1:114166729-114166751 TTTAGGAACTCCAGGTGAGAAGG - Intergenic
913326434 1:117632355-117632377 TTTCAGCATTGCAGGTGAGCTGG - Intergenic
916385824 1:164267534-164267556 TTTAGGTATTTCATGTAAGTAGG - Intergenic
918994540 1:191739864-191739886 TTTCTGTATTGCATATGAGCAGG + Intergenic
920813560 1:209309506-209309528 TTTTAGAATTGGATCTGAGCAGG + Intergenic
921384542 1:214555300-214555322 TTTAGGAATTGGAATTAAGCTGG - Intergenic
923025676 1:230201970-230201992 TGTATGAGTTTCATGTGAGCAGG + Intronic
923086621 1:230707588-230707610 TCTCGGAAGGGCATGTGAGCGGG + Intronic
1066456576 10:35577432-35577454 TTTAGGAATTGCACCTGTGTCGG - Intergenic
1070223106 10:74471556-74471578 TATAGGAATTGCATGTGCAAAGG + Intronic
1071155844 10:82687937-82687959 TTTAGGAAACTCATGTGTGCTGG - Intronic
1071828916 10:89352748-89352770 TTTAGGAATAAAATGGGAGCAGG - Intronic
1079943856 11:26716695-26716717 TTTATGAATTGGATGTGGGGAGG - Intronic
1083873429 11:65506713-65506735 TTTAGTAATTGGCTGTGAGCTGG + Intergenic
1084714232 11:70863516-70863538 ATGAGGATTTGCATGGGAGCAGG - Intronic
1092187972 12:6495269-6495291 TGTAGCAATTCCATGTGAGATGG - Intronic
1093122768 12:15292646-15292668 TTAAGGAATTGCATGCCAGCTGG - Intronic
1103424430 12:120820123-120820145 TGTAAGAATTGCATGTGAGAAGG - Intronic
1110396818 13:75039783-75039805 TTTAGTAACTACCTGTGAGCTGG + Intergenic
1111238652 13:85444370-85444392 TTTGGGCATTGCATGTAAGATGG - Intergenic
1111440090 13:88270861-88270883 TTTATGAATTGCTTGAGAGATGG - Intergenic
1112179662 13:97066044-97066066 TTTAGGAAATGGATGGGAACTGG - Intergenic
1114820128 14:26008473-26008495 TTTAGGAGGCGCAAGTGAGCTGG - Intergenic
1117048742 14:51839477-51839499 TTTGGGAATAGAATGTGAGGTGG + Intronic
1117439925 14:55749778-55749800 TTTAGGAAATGCAGCTGTGCAGG + Intergenic
1123053364 14:105558582-105558604 TTTCTGATTTGTATGTGAGCTGG + Intergenic
1123077941 14:105678996-105679018 TTTCTGATTTGTATGTGAGCTGG + Intergenic
1123473846 15:20573472-20573494 TTTAGGATTTGTATGTGCTCTGG + Intergenic
1123644162 15:22426881-22426903 TTTAGGATTTGTATGTGCTCTGG - Intergenic
1123734146 15:23168483-23168505 TTTAGGATTTGTATGTGCTCTGG + Intergenic
1124284649 15:28389794-28389816 TTTAGGATTTGTATGTGCTCTGG + Intronic
1124298049 15:28521820-28521842 TTTAGGATTTGTATGTGCTCTGG - Intronic
1124658709 15:31528099-31528121 TTTAGGAACTTCATGTGTCCCGG - Intronic
1130282117 15:82527190-82527212 CTTAGGATTTGCATGTGCTCTGG + Intergenic
1130358359 15:83156318-83156340 TGAAGGAATTGAATGGGAGCAGG - Intronic
1131488715 15:92843561-92843583 ATTGTGAACTGCATGTGAGCGGG + Intergenic
1131788613 15:95939970-95939992 TCAAGGAATTGCATTTGTGCAGG + Intergenic
1138163494 16:54777899-54777921 TTTGGGAATTGTATGTCAGGTGG + Intergenic
1138913418 16:61431473-61431495 TTTAGGAATAGGATGTGGGGAGG - Intergenic
1144618100 17:16795417-16795439 ATAAGGGATTACATGTGAGCTGG - Intronic
1144728364 17:17512950-17512972 TTTAGACCCTGCATGTGAGCAGG + Intronic
1144894604 17:18520274-18520296 ATAAGGGATTACATGTGAGCTGG + Intergenic
1145137621 17:20423970-20423992 ATAAGGGATTACATGTGAGCTGG - Intergenic
1148662147 17:49343176-49343198 GTTAAGAATTACATGTGGGCCGG - Intronic
1148708942 17:49662167-49662189 TTTAAAAATTGCATTTGGGCAGG - Intronic
1149761120 17:59231254-59231276 TTTAGTAATTCCATGTGACCAGG + Intronic
1149871516 17:60186255-60186277 ATAAGGGATTACATGTGAGCTGG + Intronic
1152928120 17:83097193-83097215 TTTAAGAAGTGCCTGTGGGCTGG + Intergenic
1153231385 18:2940028-2940050 TTTAAGAATTGCAGATGAGTGGG + Intronic
1153850858 18:9092813-9092835 TTTAGGAACTGCATATGCTCTGG + Intergenic
1156334662 18:36158585-36158607 TTTATGGATTGCATGGGAGTTGG + Intronic
1156997525 18:43485506-43485528 ATCAGCAGTTGCATGTGAGCAGG + Intergenic
1158597178 18:58826768-58826790 TGTAGGAAGGGCATGTGAGGTGG - Intergenic
1158790644 18:60776312-60776334 TGTAGTCATTGCATGTGAGATGG - Intergenic
1164467496 19:28500419-28500441 TGTAGGAATTGCATAAGGGCCGG + Intergenic
1167281680 19:48572858-48572880 TTTAAGAGTTGCATGTCTGCTGG + Intronic
1167893773 19:52564228-52564250 ATAAGGAATTGCACGTGAGATGG + Intronic
1167932531 19:52878125-52878147 ATAAGGAATTGCATATGAGATGG - Exonic
1167993844 19:53386385-53386407 ATAAGGAATTGCATGTGAGATGG + Intronic
1167996949 19:53413342-53413364 ATAAGGAATTGCACGTGAGATGG + Intronic
1168006735 19:53496034-53496056 ATAAGGAATTGCACGTGAGATGG + Exonic
928434705 2:31247208-31247230 TTTAGGAAGTGGAATTGAGCAGG + Intronic
928524521 2:32126152-32126174 TTCAGGAATTGGATGTTATCAGG - Intronic
929087609 2:38183782-38183804 CCTAGGAATTGCTTGAGAGCTGG - Intergenic
929095735 2:38261809-38261831 TTGAGGGCTTGCATGTGAGTTGG - Intergenic
929096073 2:38264310-38264332 TTGAGGGGTTGCATTTGAGCTGG - Intergenic
929214660 2:39399111-39399133 ATTGGGAATTTCGTGTGAGCAGG - Intronic
929660026 2:43774634-43774656 TTTAGGAATATCTTGTGAACAGG - Intronic
930507819 2:52305831-52305853 TTTTGGAATTGCATGGGGCCTGG + Intergenic
932357601 2:71079062-71079084 TTTAGTAACTGCAGGTAAGCAGG + Intronic
932370058 2:71179317-71179339 TTTAGTAATTGCAGGTAAGCAGG + Intergenic
933266201 2:80182709-80182731 CTGAGGCATTGCATTTGAGCTGG + Intronic
933633942 2:84686491-84686513 TTTTGGAATTGCAATTGACCTGG + Exonic
934494235 2:94783493-94783515 ATTAGGAATTTCCTGTGAACAGG - Intergenic
935955663 2:108374212-108374234 TTTCAGAATTGCACATGAGCTGG - Intergenic
936115186 2:109696515-109696537 TTTAGGAATGGCATTAGAGTAGG - Intergenic
936452279 2:112642728-112642750 GTGAGGACTTGCATGGGAGCAGG - Intergenic
943052764 2:182936744-182936766 ATTAAAAATTCCATGTGAGCAGG + Intronic
943913908 2:193603706-193603728 TTAAAGAATTGAATGTGAGCAGG - Intergenic
944041586 2:195361842-195361864 TATAGAAATTGCATTTGAGATGG + Intergenic
944633691 2:201653895-201653917 TTTAGGAGTTGCTTTGGAGCTGG + Intronic
945231956 2:207600636-207600658 TTTTGGCATTTCATTTGAGCAGG + Exonic
1168789371 20:565875-565897 TTTAAGAAGGGCATGTCAGCCGG + Intergenic
1172751061 20:37251616-37251638 GTTATGAATTCCATGAGAGCAGG + Intronic
1173966411 20:47115914-47115936 GGTGGGAAGTGCATGTGAGCAGG - Intronic
1176657143 21:9597252-9597274 TTTATGAATTGCCTGGGAACAGG + Intergenic
1179453471 21:41481394-41481416 TCTAGGCATTCCATGTGAGCGGG - Intronic
1179944100 21:44658920-44658942 TTGAGGTATTGCATGGGATCTGG - Intronic
1180605915 22:17058539-17058561 CATGGGAATAGCATGTGAGCCGG - Intergenic
1185069860 22:48650175-48650197 TGTTGGAATTGAATGTGAGTAGG + Intronic
1185200293 22:49498440-49498462 TTTAGGAGATGCCTGTCAGCTGG + Intronic
950092793 3:10308272-10308294 TCTAGGAAATGCAGCTGAGCAGG - Intronic
951517226 3:23573727-23573749 TTTAGGTATTGCAAGTGTGGAGG - Intronic
953360190 3:42288952-42288974 TTTAGCAATTCCAGGTGGGCTGG + Intergenic
955556006 3:60137976-60137998 ATTATGAATTACATGTGTGCAGG + Intronic
955564370 3:60227946-60227968 TTTAAGAACTGCAGGGGAGCTGG + Intronic
957880604 3:86207302-86207324 TATAGGAATTGCATTTGTGTTGG + Intergenic
959963287 3:112325377-112325399 TTTAGAGAGTGCATGTGATCCGG - Intergenic
960151266 3:114251265-114251287 TTTGGGATTTGCATGTGGGGAGG + Intergenic
960713469 3:120554043-120554065 TGTTGGAAATGCATGTGAGGGGG - Intergenic
962399061 3:135041415-135041437 TTGAGGAACTCCATGTGAGGAGG - Intronic
964912815 3:161802496-161802518 GTTAGGAATTGGATGTTTGCAGG - Intergenic
966260086 3:177966380-177966402 TTTAGGAATTTCAGGTAAGAGGG - Intergenic
967235985 3:187384154-187384176 TTTAGGAAGGGTAGGTGAGCTGG - Intergenic
967420736 3:189269542-189269564 TGGAGGAATGGCATGTGTGCTGG + Intronic
968145814 3:196298042-196298064 ATAAGGAACTGCACGTGAGCTGG - Intronic
968392000 4:200894-200916 TTTAGGCATTGCATGAGACATGG - Intergenic
968823820 4:2878001-2878023 CCTAGGAATTTCATGTTAGCTGG - Intronic
971769732 4:30881050-30881072 TTCAGGAAATGTATGTGAACTGG - Intronic
972002605 4:34058121-34058143 TTTTGGACTTGCATGGGACCTGG - Intergenic
973156462 4:46961195-46961217 TTTAAGAATGGCGTGTGTGCAGG - Intronic
974118665 4:57611697-57611719 TTGATCAATTGCATGTAAGCAGG + Intergenic
976197628 4:82548628-82548650 TCTATGAATTGCATGGGAGTGGG - Intronic
976413843 4:84748397-84748419 CTGAGGAATTACATGTGTGCTGG - Intronic
978423127 4:108555001-108555023 TTTAGGAACTGGTTGTGGGCAGG - Intergenic
980343614 4:131583801-131583823 ATCAGCAATTGCAGGTGAGCAGG - Intergenic
982279454 4:153668423-153668445 TGCAGGAATTGCAAGAGAGCTGG + Intergenic
982947730 4:161647811-161647833 TTTAGGAAATACATTTGGGCAGG - Intronic
983751237 4:171274488-171274510 TTTACTAATTGCATGTCAGGTGG + Intergenic
984262978 4:177464247-177464269 CTTAGGAATTGCATTTGACAAGG + Intergenic
985681960 5:1260465-1260487 TTCTGGATTTGCAGGTGAGCAGG - Exonic
987009713 5:13749760-13749782 TTGAGCAATAGCATGTGACCTGG - Intronic
987514917 5:18892799-18892821 CTTGGGAATTCCCTGTGAGCAGG + Intergenic
987906556 5:24085376-24085398 TTTAGTAATTTGATGTGAGAAGG + Intronic
988004287 5:25387825-25387847 TGCAGTAATTGCATGTGATCTGG + Intergenic
994304524 5:98186776-98186798 ACTAGGAATAGCATGTGGGCAGG + Intergenic
995861897 5:116649856-116649878 TTTTGGAATTGTGTGTGATCAGG + Intergenic
996262387 5:121489700-121489722 TTTAAAAATTGCATGGAAGCTGG - Intergenic
997595657 5:135105626-135105648 TGTAGGAAGTGGAGGTGAGCAGG + Intronic
998333940 5:141354256-141354278 TTTAGGCTTTGCATTTGAACTGG + Intronic
998615705 5:143737814-143737836 TCAAGGAATTGCATGTGTGGTGG + Intergenic
999888523 5:155950935-155950957 TTTAGGAATTGCATGTGAGCTGG + Intronic
999962590 5:156772784-156772806 CTTAAGAATTGCATATGGGCTGG - Intergenic
1000400771 5:160824817-160824839 TTTTTCAATTGCATGTGAGAAGG + Intronic
1003772235 6:9318517-9318539 TCTAGGAATTCCATGTGATTTGG - Intergenic
1004188763 6:13446276-13446298 TTTGGGAATTGCAAGTGTACAGG - Intronic
1005715260 6:28541452-28541474 TTTCAGAATTTCATGTGAGTGGG - Intergenic
1007179420 6:39917964-39917986 TCTTGGATTTGAATGTGAGCAGG - Intronic
1009440891 6:63676879-63676901 TTTGGGAGTAGCATGTTAGCTGG + Intronic
1010766508 6:79781789-79781811 GTGAGGAATTGAATGTGAGGTGG + Intergenic
1013477975 6:110527097-110527119 TTTTGGATTTGAGTGTGAGCAGG - Intergenic
1016440899 6:144082235-144082257 TGTATGAACTGCATTTGAGCTGG - Intergenic
1017120368 6:151018408-151018430 TTAAGGAGTTGTTTGTGAGCTGG + Intronic
1017525311 6:155237182-155237204 TTTCGGAATTGCATGGGGCCTGG - Intronic
1018295017 6:162336606-162336628 ATTTGAGATTGCATGTGAGCGGG + Intronic
1019372083 7:667584-667606 TTTAGGCATTGCCAGTGAGCGGG - Intronic
1021910663 7:25383095-25383117 TTAAGGAAGAGAATGTGAGCAGG + Intergenic
1022162455 7:27725297-27725319 TTTAAAAATTACATGTGGGCTGG - Intergenic
1026528938 7:71180699-71180721 TTTAGGAGTTGTATTTCAGCTGG + Intronic
1028060239 7:86304265-86304287 TTTAGGAATTGCATTTCCTCTGG - Intergenic
1029282550 7:99445553-99445575 TTTAATAATTGTATGTGGGCCGG + Intronic
1037102567 8:15065238-15065260 CATAGGAAATGCATGTGTGCAGG - Intronic
1039956538 8:42211420-42211442 TTTAAAAAATGCATGTCAGCAGG - Intergenic
1040561706 8:48528414-48528436 TATGGGAAATGCATGTGAGAGGG + Intergenic
1044296659 8:90535680-90535702 TTAAGGGATTGCATGTCAGTTGG - Intergenic
1046405478 8:113767442-113767464 TTTAGAAATGGCATATGAGTAGG + Intergenic
1050583125 9:7081906-7081928 TTTAGAAATTGAATCAGAGCAGG + Intergenic
1053302779 9:36963594-36963616 TAGAGGAGTGGCATGTGAGCAGG + Intronic
1053662891 9:40296873-40296895 ATTAGGAATTTCCTGTGAACAGG + Intronic
1053664265 9:40306580-40306602 ATTAGGAATTTCCTGTGAACAGG + Intronic
1053913338 9:42927048-42927070 ATTAGGAATTTCCTGTGAACAGG + Intergenic
1054375019 9:64443097-64443119 ATTAGGAATTTCCTGTGAACAGG + Intergenic
1054520351 9:66069705-66069727 ATTAGGAATTTCCTGTGAACAGG - Intergenic
1054521724 9:66079411-66079433 ATTAGGAATTTCCTGTGAACAGG - Intergenic
1055975955 9:81955456-81955478 TTTTGGACTTGCATGGGACCTGG - Intergenic
1058733118 9:107869150-107869172 CTTTGGGATGGCATGTGAGCTGG + Intergenic
1058869354 9:109189058-109189080 TTTAGGATGTGAATGTGAGCAGG - Intronic
1060815489 9:126632974-126632996 TGTGGGAATGGCAGGTGAGCTGG - Intronic
1062219685 9:135408510-135408532 TTTAGGCACGGCATGTGAGGCGG - Intergenic
1203405974 Un_KI270538v1:2451-2473 TTTAGGAATTCGTTGTAAGCGGG + Intergenic
1203634866 Un_KI270750v1:100826-100848 TTTATGAATTGCCTGGGAACAGG + Intergenic
1186357984 X:8807367-8807389 TTTACCAATTACATGTGAGAAGG + Intergenic
1186610935 X:11137890-11137912 TTAAGGAATTGCATGTAATTTGG + Exonic
1187302043 X:18059988-18060010 TTCATGAAATGCATGTGAGCTGG - Intergenic
1188590062 X:31822908-31822930 ATAAGGAAATGAATGTGAGCTGG - Intronic
1188799754 X:34514303-34514325 TTTAGGCTTTGCATGTTATCAGG - Intergenic
1189852564 X:45192035-45192057 TTGAGGATTGGCCTGTGAGCTGG + Intronic
1190490527 X:50978424-50978446 ATTAGGAAAGGAATGTGAGCTGG + Intergenic
1190568376 X:51755163-51755185 TTTAAGAATTGAATATAAGCGGG + Intergenic
1197553214 X:127920529-127920551 TTGAGTCATTGCATGTGAGATGG + Intergenic
1199934158 X:152554822-152554844 ATTAGGAATTGCTTTTAAGCTGG + Intergenic