ID: 999889417

View in Genome Browser
Species Human (GRCh38)
Location 5:155960405-155960427
Sequence CTCAAACAGAAGACTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999889417_999889423 16 Left 999889417 5:155960405-155960427 CCCAGGCCAGTCTTCTGTTTGAG 0: 1
1: 0
2: 0
3: 9
4: 162
Right 999889423 5:155960444-155960466 CCTGTATCTTTCTCCTAGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 379
999889417_999889421 -7 Left 999889417 5:155960405-155960427 CCCAGGCCAGTCTTCTGTTTGAG 0: 1
1: 0
2: 0
3: 9
4: 162
Right 999889421 5:155960421-155960443 GTTTGAGGCAAAGAGAGCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 202
999889417_999889425 29 Left 999889417 5:155960405-155960427 CCCAGGCCAGTCTTCTGTTTGAG 0: 1
1: 0
2: 0
3: 9
4: 162
Right 999889425 5:155960457-155960479 CCTAGCCTGGTCCAATTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999889417 Original CRISPR CTCAAACAGAAGACTGGCCT GGG (reversed) Intronic
900569477 1:3351300-3351322 CTCAATCAGAAGTCTCTCCTGGG - Intronic
902867031 1:19286338-19286360 CCCAAACAGTGGAATGGCCTTGG + Exonic
906539821 1:46576761-46576783 GTCCAGCAGAAGTCTGGCCTAGG + Intronic
906557082 1:46722368-46722390 ATGAAGCAGAAGACTGGGCTAGG - Intergenic
906860489 1:49353823-49353845 GTCAGAGAGAAGACTGGCCATGG + Intronic
908342760 1:63198905-63198927 TAAAAACAGAAGTCTGGCCTGGG - Intergenic
910910220 1:92225338-92225360 CTCCAGCAGTACACTGGCCTTGG + Intronic
910985436 1:93000483-93000505 CTCAAGGGGAAGACTGTCCTAGG + Intergenic
912571908 1:110630997-110631019 CTCAAGCACAGGTCTGGCCTTGG + Intronic
915541728 1:156571733-156571755 CTTTAACAGAAGACTGGACATGG + Intronic
916828906 1:168471007-168471029 TACAAACATAAGACTGGCTTGGG + Intergenic
918224111 1:182464427-182464449 GAAAAACAGAAGACTGGCCGGGG + Intronic
919533445 1:198754973-198754995 CTCATCCAGAAGACTAGCCCAGG + Intronic
924385174 1:243493127-243493149 CTCAAACAAAAGACAGGCCAGGG - Intronic
1063658473 10:8014966-8014988 CTCAAGCAGAGGCGTGGCCTGGG + Exonic
1063690006 10:8278153-8278175 TGCAGACAGAAGACGGGCCTGGG - Intergenic
1064907274 10:20360320-20360342 TTTAAACAGAGGACTGGCCGTGG + Intergenic
1065353960 10:24820976-24820998 CTCCAACAGTAGCCTGTCCTGGG + Intergenic
1065735294 10:28745876-28745898 CCCAAAGAGAGGTCTGGCCTTGG + Intergenic
1065758915 10:28963653-28963675 GACAAACAGAACAATGGCCTGGG - Intergenic
1066228627 10:33410329-33410351 CTCAAGCAAAATTCTGGCCTTGG - Intergenic
1066346574 10:34592478-34592500 ATCAAAAAGAGGACTGGGCTGGG + Intronic
1067248410 10:44565957-44565979 CTCTAAGAGGAGACAGGCCTGGG + Intergenic
1067542608 10:47166634-47166656 CTCAGAGCGAAGTCTGGCCTTGG + Intergenic
1072148512 10:92665651-92665673 CTCATTCACAAGACTTGCCTTGG - Intergenic
1075472147 10:122699213-122699235 CTCAAACAGTAGACTCCCATTGG - Intronic
1076828191 10:132980997-132981019 CACACACAGAAGCCTCGCCTGGG - Intergenic
1077722607 11:4643538-4643560 CTCAAACAGGAGAATGGCAAAGG - Exonic
1083311701 11:61787069-61787091 CTCAAGCAGCAGCCTGGTCTTGG + Exonic
1084042759 11:66551840-66551862 CTCAAGCAGTCCACTGGCCTTGG - Intronic
1084654524 11:70507428-70507450 CTGACACAGGAGACTGGCCTGGG - Intronic
1086302158 11:85438604-85438626 CACAAACAGGATACTGGCATTGG + Intronic
1090070939 11:123544507-123544529 GTCAAAAAGAAAACTGGCCAAGG - Intronic
1090745635 11:129702734-129702756 CTCAAACAGAAGCATGGAGTTGG + Intergenic
1093399017 12:18720472-18720494 ATCAAGCAGAAGACTGGCTCTGG + Intronic
1094550375 12:31445468-31445490 CTCAAACAAAACACCTGCCTTGG - Intronic
1099035043 12:77576407-77576429 ATCAAACAGAAGCGTGGTCTGGG + Intergenic
1100489584 12:95066266-95066288 CTCAAGCAGTTCACTGGCCTTGG - Intronic
1103102910 12:118195748-118195770 CTCAAAAAGAAGACTGGATTGGG + Intronic
1107143429 13:37030518-37030540 CTCAATCAGAAGAATCACCTAGG - Intronic
1109498277 13:63204100-63204122 CTCAAAAAGTAGCCTGCCCTTGG - Intergenic
1110627228 13:77664970-77664992 CTCAAAGAGAGGTTTGGCCTTGG - Intergenic
1112821108 13:103336849-103336871 CTCAAACTGAAGAGTTTCCTGGG - Intergenic
1113554825 13:111224401-111224423 CACACACAGAAAACTGGTCTTGG - Intronic
1118462105 14:65996768-65996790 CTCCAAAAGTAGAGTGGCCTGGG - Intronic
1202891590 14_KI270722v1_random:164277-164299 GCCAAACAAAAGTCTGGCCTAGG + Intergenic
1126376803 15:48005188-48005210 CTCAGAAAGAAGAATGGCTTCGG - Intergenic
1127772979 15:62245384-62245406 TTCAAACTGAATTCTGGCCTCGG - Intergenic
1128820268 15:70645942-70645964 TTCAAGCAGAAGACTTGGCTGGG + Intergenic
1130417969 15:83712337-83712359 CTGCAACTGAAAACTGGCCTTGG + Intronic
1131282643 15:91033717-91033739 TTCAAACTGAATTCTGGCCTCGG - Intergenic
1135190053 16:20347336-20347358 CTCAAACAGAGAGCAGGCCTCGG + Intronic
1136267499 16:29130186-29130208 CTCCCACAGAGGACTGGCGTGGG + Intergenic
1137945563 16:52730648-52730670 GTCAATCAGAAGGGTGGCCTTGG + Intergenic
1140347614 16:74229191-74229213 CTCAAGCAGAACACTCACCTTGG - Intergenic
1142159642 16:88550419-88550441 CCCACACAGAAGGCTGCCCTTGG + Intergenic
1143215248 17:5220074-5220096 CTCAAGCCTAAGAGTGGCCTTGG + Intronic
1143981747 17:10876078-10876100 CCCAAGCAGAAGACTCACCTGGG + Intergenic
1144142326 17:12361721-12361743 TTCAGAGAGAGGACTGGCCTGGG + Intergenic
1146604542 17:34246935-34246957 ATCATACAGAAGATTGGGCTTGG + Intergenic
1146663126 17:34678431-34678453 CTCAGACTCAAGAGTGGCCTTGG + Intergenic
1150759290 17:67945713-67945735 CACGAACAGGAGACTGTCCTTGG - Exonic
1151081333 17:71333085-71333107 CTCAAACAGTCCACTTGCCTGGG - Intergenic
1158159958 18:54469812-54469834 CTCAGACAGAATTCTTGCCTGGG - Intergenic
1158419696 18:57281977-57281999 CTGTAAAAGAAGACTGGCCCAGG - Intergenic
1158442908 18:57493016-57493038 ATCATCCAGCAGACTGGCCTGGG + Intergenic
1160702007 19:512164-512186 CTCAAAAAGAAAACTGGGCCAGG - Intronic
1167496369 19:49821280-49821302 CTCAAAAACAAGAGAGGCCTGGG - Intronic
1167910121 19:52694933-52694955 CTAAAACAGGAGAATTGCCTGGG + Intergenic
926165247 2:10518880-10518902 CTCACCCAGAGGCCTGGCCTGGG - Intergenic
929102939 2:38334261-38334283 CTCAAGCAGTCGACTTGCCTCGG + Intronic
933462257 2:82603151-82603173 CAAAGAGAGAAGACTGGCCTGGG - Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
934893175 2:98088210-98088232 CTGAAAAAGAAGTCTGGGCTAGG - Intronic
935173988 2:100631855-100631877 CTATAGCAGAAGACTGGCTTTGG - Intergenic
935736030 2:106107327-106107349 ATCAGACTGAAGACTGGCCTCGG - Intronic
939825766 2:147013804-147013826 CTCAAACAGCAGAGTGTCTTAGG + Intergenic
940242487 2:151578377-151578399 CTTAAACAGAAGAATGTCCATGG - Intronic
940243479 2:151589055-151589077 CTTAAACAGAAGAATGTCCATGG - Intronic
940244435 2:151599608-151599630 CTTAAACAGAAGAATGTCCATGG - Intronic
944431079 2:199634226-199634248 CTCACACAGAAGTTTAGCCTGGG + Intergenic
944680158 2:202070012-202070034 ATCCAAGAGAAGACTGGCCTGGG + Intergenic
945154164 2:206820532-206820554 CTCAACCATAAGACTTGCTTTGG + Intergenic
1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG + Intronic
1170842940 20:19938840-19938862 CTCAAAGAGAGGATTGGCCAAGG - Intronic
1171002964 20:21433436-21433458 GTCAATCAGAAGACAGGCCCAGG - Intergenic
1177694168 21:24551079-24551101 TTCAATCAGAAAACTGTCCTTGG + Intergenic
1177829918 21:26126534-26126556 CTCAAAAAGCAAAGTGGCCTAGG - Intronic
1178273621 21:31216596-31216618 CCCCAGCAGGAGACTGGCCTTGG + Intronic
1178492365 21:33060879-33060901 GTCAGACAGAAGAATGGGCTTGG + Intergenic
1179889387 21:44327968-44327990 CTCAACCAGGAGACTGCCCAGGG - Intergenic
1181108931 22:20590295-20590317 CTCAACCAGAATCCTGGGCTGGG + Intergenic
1184231157 22:43159187-43159209 CTGAAAGAGAAGACAGGGCTGGG - Intronic
949860319 3:8499397-8499419 GGCCAACAGAAGCCTGGCCTGGG - Intergenic
960510154 3:118540173-118540195 GTCAAACATAAATCTGGCCTAGG - Intergenic
964359738 3:155882138-155882160 CTCAAGCACAAGACTTGCTTTGG - Intronic
964531190 3:157669571-157669593 CTCAAAAAGAAGAATGCCATTGG - Intronic
965502294 3:169471223-169471245 CTCAAGCAATACACTGGCCTCGG + Intronic
965694018 3:171388144-171388166 CTCAATACAAAGACTGGCCTGGG + Intronic
966037246 3:175434365-175434387 CAAGAAAAGAAGACTGGCCTGGG - Intronic
966886927 3:184381968-184381990 CTCAAACAGGACACTGCCATTGG - Exonic
967596091 3:191328494-191328516 GTCAAACAGAATACTTTCCTGGG - Intronic
968152169 3:196345558-196345580 CTCAAGCAGAAGACATGCCTCGG + Intergenic
968921972 4:3527069-3527091 CCCAGACAAAAGACTGTCCTGGG - Intronic
970572662 4:17398239-17398261 CCCAGACAGAAGAGAGGCCTGGG + Intergenic
970616612 4:17773870-17773892 CTCAAACTGAAGGCTTGGCTGGG - Intronic
976747880 4:88423378-88423400 CAAAAACAGGAGACTGCCCTTGG - Intronic
981145150 4:141315370-141315392 CTGAAACAGAAGACAGCCCAAGG + Intergenic
984748630 4:183250099-183250121 CTAAAACCGAAGGGTGGCCTTGG - Intronic
986740943 5:10704712-10704734 CACAAACAGAAGACAGGTGTTGG - Intronic
986998472 5:13634347-13634369 CTCAAACAGAAGGCTTACCCAGG - Intergenic
988707291 5:33738783-33738805 CTCCTCCAGAACACTGGCCTTGG - Intronic
990316111 5:54584790-54584812 CTCACACAGATGGCTGGTCTTGG + Intergenic
992432906 5:76726900-76726922 GTCACACAGAAGCCTGACCTTGG - Intronic
992852757 5:80827804-80827826 TTCAATCAGAAGATTTGCCTGGG - Intronic
993089065 5:83401167-83401189 CTCAAACATAAGAAGGACCTGGG - Intergenic
993486181 5:88488786-88488808 CTCAAATAGAAGAAAAGCCTAGG + Intergenic
995006207 5:107198841-107198863 CTCAAATAAAATACTAGCCTGGG - Intergenic
996087671 5:119321214-119321236 CTCAAAAAAAAGACTAGACTTGG + Intronic
997779414 5:136641680-136641702 CTCAAGCAGATGGCTGGACTGGG - Intergenic
998383963 5:141745467-141745489 CTGAAAAGGGAGACTGGCCTGGG - Intergenic
999889417 5:155960405-155960427 CTCAAACAGAAGACTGGCCTGGG - Intronic
1002157553 5:177294969-177294991 CTGAGAAAGAAGTCTGGCCTGGG - Exonic
1004145245 6:13059968-13059990 CTCATCTAGAAGACTGTCCTTGG - Intronic
1004154477 6:13155365-13155387 CACAAACAGAAGCCAGGGCTGGG - Intronic
1005218766 6:23562401-23562423 CTCAACCAGAAGACTGGGGCTGG + Intergenic
1005733549 6:28722412-28722434 CTGAGACAGAAGAATTGCCTGGG + Intergenic
1007077988 6:39079879-39079901 CTTACAGAGAAGACTGGCCCAGG - Intronic
1008276436 6:49549696-49549718 CACAAAATGAAGACTGGCCAGGG + Intergenic
1010620277 6:78064959-78064981 TACAGACAGAAGACTGGTCTTGG - Intergenic
1010661357 6:78574086-78574108 CTGACACAGAAAACTGTCCTGGG - Intergenic
1012267416 6:97162615-97162637 AACAAACAGAGGACTGTCCTAGG + Intronic
1012580132 6:100857905-100857927 CTCAAACATAAGACTGTGCCTGG + Intronic
1012968231 6:105698586-105698608 CTGCAATAGAAGAATGGCCTAGG - Intergenic
1014090545 6:117399368-117399390 CTCAGACCAAACACTGGCCTAGG - Intronic
1014828041 6:126068923-126068945 CTGTAACAGAAGTCTGGCATTGG + Intergenic
1017059954 6:150473640-150473662 CTCAAGAAGAACATTGGCCTAGG - Intergenic
1019667209 7:2257866-2257888 CTCAGACCCAAGCCTGGCCTGGG + Intronic
1020073551 7:5243083-5243105 CCCAAATAGAAGACTCTCCTGGG + Intergenic
1020522773 7:9214849-9214871 AACAATCAGAAGACTGGGCTTGG - Intergenic
1022497234 7:30860767-30860789 CACAACATGAAGACTGGCCTGGG - Intronic
1026512752 7:71040626-71040648 GTCAAACAGAAGACAGCCCTGGG + Intergenic
1028980418 7:96962082-96962104 TTGAAACAGAGGACTAGCCTGGG - Intergenic
1028987724 7:97021300-97021322 CCCAAACAAAAGACAAGCCTTGG - Intronic
1030543883 7:110868281-110868303 TTCAAACAGAAAAATGGGCTTGG - Intronic
1032728187 7:134611685-134611707 CAGAAACACAAGACCGGCCTGGG - Intergenic
1033499895 7:141937118-141937140 CTCAAGCAGAAGAATGTGCTGGG - Intronic
1034493691 7:151407956-151407978 CCCAAACATAAGACTGTCTTGGG - Intronic
1034790207 7:153961362-153961384 CCTACACAGAAGACTGGCCCTGG - Intronic
1038401809 8:27289406-27289428 CTCCAAGACAAGACTGGACTGGG + Intronic
1039882757 8:41635870-41635892 CTCAAACAGAAGGCCGGGCGCGG + Intergenic
1039895579 8:41714370-41714392 CTCCAAGTTAAGACTGGCCTGGG - Intronic
1044777980 8:95713654-95713676 ATCAAACAGACGGCAGGCCTTGG - Intergenic
1046543326 8:115615073-115615095 CTCAAACATAAGACAGTACTTGG + Intronic
1047938833 8:129807935-129807957 CTCAGACAGAAGCCTGGCACAGG + Intergenic
1050196250 9:3087248-3087270 CTGAAAGAGAAGACTGGGGTGGG + Intergenic
1050270126 9:3934697-3934719 ATCAAACAGAAGGCTGGGCACGG - Intronic
1056450100 9:86708472-86708494 GACAAGCAGAAGAGTGGCCTGGG - Intergenic
1062530180 9:136996259-136996281 CTCCTCCAGAAGACTGGGCTGGG + Intronic
1203779151 EBV:91378-91400 CTCCAACAGATGACTTGCCTCGG + Intergenic
1186251881 X:7676927-7676949 GTCTAAGAGAAGACTGGTCTGGG - Intergenic
1190230970 X:48581599-48581621 CTCAAAAATAAGCATGGCCTTGG + Intergenic
1190717866 X:53119271-53119293 CTCAAAAATAAGACTAGCCTGGG - Intergenic
1192196852 X:69034275-69034297 TTCAGACTGGAGACTGGCCTTGG - Intergenic
1194001883 X:88439843-88439865 TTCAAACTGAAGACTGGGCCAGG - Intergenic
1198624252 X:138551266-138551288 GGCAAACAGAAAAATGGCCTTGG - Intergenic
1201062251 Y:10057702-10057724 CTCAAGTAGAAGAGTGGCATTGG + Intergenic
1202161056 Y:21937718-21937740 CTCAAGCAGTCCACTGGCCTGGG + Intergenic
1202230300 Y:22648655-22648677 CTCAAGCAGTCCACTGGCCTGGG - Intergenic
1202312856 Y:23547510-23547532 CTCAAGCAGTCCACTGGCCTGGG + Intergenic
1202557946 Y:26123084-26123106 CTCAAGCAGTCCACTGGCCTGGG - Intergenic