ID: 999892382

View in Genome Browser
Species Human (GRCh38)
Location 5:155993151-155993173
Sequence CAGAAGGACTGAAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 839
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 760}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999892382_999892391 10 Left 999892382 5:155993151-155993173 CCATTTTCCCTTCAGTCCTTCTG 0: 1
1: 0
2: 6
3: 72
4: 760
Right 999892391 5:155993184-155993206 CGCCATGGAACATTCCTGCATGG 0: 1
1: 0
2: 0
3: 0
4: 91
999892382_999892386 -5 Left 999892382 5:155993151-155993173 CCATTTTCCCTTCAGTCCTTCTG 0: 1
1: 0
2: 6
3: 72
4: 760
Right 999892386 5:155993169-155993191 TTCTGCCTCTTGCCCCGCCATGG 0: 1
1: 0
2: 1
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999892382 Original CRISPR CAGAAGGACTGAAGGGAAAA TGG (reversed) Intronic
900799460 1:4728349-4728371 CACAATGACTCCAGGGAAAAAGG - Intronic
901719301 1:11183137-11183159 CAGAAGGGCTGAAATGGAAAAGG - Intronic
902039421 1:13482135-13482157 CAAAAGGAAGGAAGGGAAGATGG + Intronic
902452584 1:16506759-16506781 CAGCTGCACTGAAGGGAAATCGG + Intergenic
902948056 1:19857781-19857803 AAGAAGGACAGAAGTGGAAATGG + Intergenic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
903426852 1:23259973-23259995 CTGAAGGACTGTGGGGAACAGGG + Intergenic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
904104729 1:28069625-28069647 GAGAAGGAAGGAAGGGAAAGAGG + Intronic
904480743 1:30791748-30791770 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
904486074 1:30825156-30825178 CAGGAGGACTGCTGGGAGAAAGG + Intergenic
904897434 1:33827454-33827476 CACAAACACTTAAGGGAAAAGGG - Intronic
905258395 1:36700399-36700421 AAGAAGGAAAGAAGGAAAAAAGG - Intergenic
905258421 1:36700492-36700514 AAGAAGGAAAGAAGGAAAAAAGG - Intergenic
906236091 1:44211759-44211781 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
906505957 1:46379811-46379833 CAGAAGAACAGAAGGGAAAAGGG + Intergenic
907351753 1:53837950-53837972 CGGATGGACTGAATGGAAATTGG - Intronic
907486743 1:54783145-54783167 TAGAAGGAAGCAAGGGAAAAGGG + Intronic
907961554 1:59288186-59288208 CAGAAGGACTGAATGGTGAGGGG - Intergenic
908154515 1:61338712-61338734 CAGAAGGACTAATGAGGAAATGG + Intronic
908274457 1:62455719-62455741 GACAAGGACTTAAGGGATAATGG + Intronic
908307759 1:62840786-62840808 CAAAAGGACTGATGAGAAAGAGG + Intronic
908487969 1:64614057-64614079 GAGAAGTACTGAGCGGAAAATGG - Intronic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
909682477 1:78308054-78308076 CATAAAGATTGAAGGGAAAATGG + Intronic
909972093 1:82002873-82002895 CAGAACGAGGGAAGGGAAATAGG + Intergenic
910017224 1:82540791-82540813 CAGAAGAAGAAAAGGGAAAAGGG + Intergenic
910407256 1:86901933-86901955 CAGAAGGACTGAAGAACAAGGGG - Intronic
910701956 1:90085026-90085048 CAGAAGGAAGGAAGATAAAAAGG - Intergenic
911973929 1:104467624-104467646 CACAAAGAGGGAAGGGAAAAGGG + Intergenic
912980647 1:114368590-114368612 CACAAAGAGGGAAGGGAAAAAGG + Intergenic
913157872 1:116117856-116117878 CAGAAAGAAAGAAGGGGAAAAGG - Intronic
913632614 1:120724309-120724331 GAGAAGGACTGAGGGGGAGAAGG - Intergenic
913658350 1:120983227-120983249 CAGAAGGTCTAAAGTTAAAAAGG + Intergenic
914009711 1:143766314-143766336 CAGAAGGTCTAAAGTTAAAAAGG + Intergenic
914193142 1:145428184-145428206 TAGGAAGACTGAAGGGCAAAGGG + Intergenic
914648329 1:149674975-149674997 CAGAAGGTCTAAAGTTAAAAAGG + Intergenic
914825208 1:151134519-151134541 CAGAAGGAGAGAAGGACAAAAGG + Intronic
915774945 1:158472859-158472881 AAGAAGGAATGAAGGAAGAAAGG + Intergenic
916121861 1:161535526-161535548 CAGAAAGACTAAATGGAAAAGGG - Intergenic
916131456 1:161615475-161615497 CAGAAAGACTAAATGGAAAAGGG - Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916492423 1:165313696-165313718 CAGAAGAGCTGAAGGCAGAAGGG - Intronic
916498203 1:165364433-165364455 GAGAAGAAATGAAGGGGAAAAGG + Intergenic
917130100 1:171732669-171732691 CAGCAGTACTTAAAGGAAAATGG + Intronic
918469958 1:184861699-184861721 AAGAAGGAAGGAAGGGGAAAAGG + Intronic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
918543248 1:185654341-185654363 AAGAAGGAAGGAAGGAAAAATGG - Intergenic
919273709 1:195384981-195385003 CAGAGGGCTAGAAGGGAAAATGG + Intergenic
919306438 1:195845270-195845292 CATAGGGACAGAAGGTAAAACGG - Intergenic
919382535 1:196876479-196876501 CAGAAGAATAGAAGAGAAAATGG - Intronic
920227936 1:204451380-204451402 CCCAAGGACTGAAGGGAAGAGGG - Intronic
921303564 1:213773043-213773065 CCAGAGGACTGAAGGGGAAAAGG - Intergenic
921712147 1:218383642-218383664 CAGTATGGCTGAAGGGACAAAGG - Intronic
922057441 1:222054962-222054984 AAGAAGGAAGGAAGGGAAAGAGG + Intergenic
922070636 1:222189285-222189307 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
922543655 1:226437709-226437731 GAGGAGGGCTGAAGGGAAACTGG - Intergenic
922846333 1:228687938-228687960 CAGAAGGAAGGAAGGGACAGAGG - Intergenic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923242448 1:232098907-232098929 AAGAAGGAGAGATGGGAAAAGGG + Intergenic
923533408 1:234829550-234829572 CAGAAGAATTGATAGGAAAAAGG + Intergenic
923996032 1:239495400-239495422 GAGAAGGACTGTAGGCTAAAAGG - Intronic
924641847 1:245840779-245840801 GAGCAGGTCTGAAAGGAAAAGGG + Intronic
1063091846 10:2872619-2872641 CATAGGGAGTGAAGGGCAAAGGG + Intergenic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1064405683 10:15060050-15060072 CAGAAGGAGAGAAGAGAAGAGGG - Intronic
1064773718 10:18752320-18752342 CAGGAAGACTGAAGGGCAAGTGG + Intergenic
1064934771 10:20667435-20667457 AAGAAGGAATGAATGGACAATGG - Intergenic
1064956273 10:20914441-20914463 AGGAATGACTAAAGGGAAAAGGG - Intronic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065206299 10:23360762-23360784 TAGAAAGACTCATGGGAAAAAGG - Intergenic
1065374873 10:25028608-25028630 AAGAAGCACAGATGGGAAAAAGG - Intronic
1065445215 10:25791328-25791350 CAGAAGGAGGGAAGAGAGAAGGG + Intergenic
1065874170 10:29982927-29982949 CAGAAAGAAGGAAGGGAAGAAGG + Intergenic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1067690395 10:48497908-48497930 CAGCAGGCCTGAAGAGATAAAGG + Intronic
1067781944 10:49214089-49214111 CAGGGGGCCTAAAGGGAAAATGG - Intergenic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1068299645 10:55121723-55121745 CAAAAGGACAGAAGGGTAAAAGG - Intronic
1068393967 10:56437124-56437146 CAGAAGGACAGAAGGGTAGGAGG + Intergenic
1068662229 10:59634365-59634387 CAAAATGACTGTGGGGAAAATGG - Intergenic
1068725763 10:60300788-60300810 CAGAAAGACAGAGGAGAAAATGG - Intronic
1068803856 10:61172682-61172704 CAGAAGGAAGGAAGGAAAGAAGG + Intergenic
1069504306 10:68983646-68983668 AAGAAGGACTTAAGGGAGTAGGG + Exonic
1069567345 10:69472628-69472650 AAGAGGGTCTGAAGGGGAAATGG + Intronic
1069739727 10:70679686-70679708 CAGAGGCACTGAAGGCAAAGGGG - Intronic
1070053625 10:72913293-72913315 CACAGGGACTGCAGAGAAAAAGG - Exonic
1070251570 10:74777996-74778018 CAGGTGGACTGAAGGGAGAAAGG - Intergenic
1070331284 10:75419093-75419115 GTGAAGGACTGAAAGGAAGATGG - Intergenic
1070416148 10:76191425-76191447 TAGAAGGAATGAAGTGACAAAGG - Intronic
1070654094 10:78259205-78259227 CAGAAGGACAAAAGGCAAAAGGG - Intergenic
1070665395 10:78339010-78339032 GAGATGGATTGAAGGGAACAAGG - Intergenic
1070698227 10:78578933-78578955 AAGAAGCACTGAATGGAAAGGGG - Intergenic
1071137511 10:82469202-82469224 CGGAAGGAAGGGAGGGAAAAGGG - Intronic
1071228858 10:83562846-83562868 CAGAAGATATGATGGGAAAAGGG + Intergenic
1071468506 10:85962007-85962029 CAGAAGGAAGGAAGGAAAGAAGG + Intronic
1071483295 10:86080518-86080540 AAGAAGGAAGGAAGGAAAAAAGG + Intronic
1071519519 10:86320488-86320510 CAGAAGGAGAGAAAGGAGAATGG + Intronic
1072293382 10:93987334-93987356 AAGATGGACAGAAGGGAGAAAGG + Intergenic
1072353051 10:94577275-94577297 CAGAAGGCATGAAAGAAAAAAGG - Intronic
1072442417 10:95468750-95468772 GAGAAGGACTGAAGGAAATAAGG + Intronic
1072888818 10:99303324-99303346 CAGGAGGTCTGAAGTTAAAAAGG - Intergenic
1072914175 10:99527020-99527042 GGGAAGGGCAGAAGGGAAAAGGG + Intergenic
1073838927 10:107475894-107475916 TAGAGGGTTTGAAGGGAAAAAGG - Intergenic
1074195414 10:111180287-111180309 AAGAAGGAAGGAAGGGAAGAAGG - Intergenic
1074467147 10:113693336-113693358 CAGAAGGAGCAAAGAGAAAAGGG - Intronic
1074699407 10:116079990-116080012 CAGAAAGCCTGCTGGGAAAAAGG + Intronic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075221300 10:120587169-120587191 TAGGAGGAGTGAAGGGGAAATGG + Intronic
1075997965 10:126893465-126893487 CAGATGCGCTGCAGGGAAAAGGG - Intergenic
1076001482 10:126916636-126916658 CAGAAGGAATGAGGGAAGAAGGG - Intronic
1076069919 10:127480899-127480921 CAGAAGCTCTCCAGGGAAAATGG + Intergenic
1076079338 10:127564536-127564558 AAGAAGGAAAGAAGGGAGAAAGG - Intergenic
1076199688 10:128548032-128548054 TAGAAGGAAAGAAGGAAAAAAGG + Intergenic
1076766226 10:132635293-132635315 CAGCAGGAATGAGGGGAAAAGGG - Intronic
1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG + Intronic
1077354347 11:2108268-2108290 CAGAGGGAGTGAAGGGAGAGAGG + Intergenic
1077676257 11:4195501-4195523 CAGACTGACTGAATGGAAGATGG - Intergenic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1077898027 11:6468671-6468693 CAGAGTGACTGAAGAGTAAATGG + Intronic
1078965072 11:16329993-16330015 AAGAAGAAATGAAGGAAAAAGGG - Intronic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1079419711 11:20274549-20274571 CAGAAGTACTGTATGTAAAATGG - Intergenic
1079656881 11:22995821-22995843 AAGAAAGCCTCAAGGGAAAACGG - Intergenic
1079816211 11:25062134-25062156 CAGGAGAAAGGAAGGGAAAAAGG + Intronic
1079873640 11:25830758-25830780 TAGAAGGGCAGAAGGGCAAAAGG + Intergenic
1080170946 11:29302029-29302051 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1080539002 11:33248762-33248784 TGGAAGGACTGAAGGGAAGAAGG + Intergenic
1080555962 11:33417751-33417773 CAGAAGGACAGAAGGAAGGAAGG - Intergenic
1080749310 11:35138363-35138385 CAGAAGGACATAAGGAAAGATGG + Intergenic
1080928250 11:36781124-36781146 CAGCAAGATTGAAGGGAGAAAGG - Intergenic
1081594124 11:44447439-44447461 CTGAAGGGCTGATGGGAAACAGG + Intergenic
1081613079 11:44575086-44575108 CAGTAGGGCTGAAGCGAAACTGG - Intronic
1081639341 11:44742268-44742290 AAGAAAGAAGGAAGGGAAAAAGG - Intronic
1082717124 11:56627833-56627855 AAGAAGGACAGAAGAGAAAGTGG + Intergenic
1082728246 11:56763590-56763612 CAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1082890452 11:58133346-58133368 CAGGAGGGCTGAAGGCATAAGGG + Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1084348772 11:68578053-68578075 CAGAAGGACTTAAGACTAAACGG - Intronic
1084368211 11:68717528-68717550 CAGATGGAAAGAAGGGAAAGGGG + Intronic
1084421294 11:69061892-69061914 CAGAAGGAAGGCAGGGAAGATGG + Intronic
1084497523 11:69513607-69513629 GAGAAGGAAGGAAAGGAAAAAGG - Intergenic
1084501761 11:69539399-69539421 CAGAAGGAAGGAAGGAAAGAGGG + Intergenic
1084560274 11:69901256-69901278 CAGAAAGAAGGAAGGAAAAAAGG + Intergenic
1084560516 11:69903103-69903125 CAGAAAGAAGGAAGGAAAAAAGG + Intergenic
1085249386 11:75132229-75132251 AAGAAGGAAGGAAGGGAGAAAGG + Intronic
1085781305 11:79411612-79411634 AAGAAAGACTGGAGGGAGAAGGG - Intronic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086863189 11:91949094-91949116 CAGAAGGATTGAAGACCAAAGGG + Intergenic
1087501184 11:98956054-98956076 CAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1087621703 11:100550324-100550346 AGGAAAGACTGAAGGGTAAATGG + Intergenic
1088351904 11:108899183-108899205 CAGAACTACTGCAGAGAAAAGGG - Intronic
1088648831 11:111939340-111939362 CATAAGGGCATAAGGGAAAAGGG + Intronic
1088897856 11:114091621-114091643 CAGAAGGAAGGAAGGGAGGAAGG - Intronic
1089148006 11:116344517-116344539 CAGAATGTCTGAAATGAAAAAGG + Intergenic
1089379756 11:118019807-118019829 CAGCAGCAATGAAGGGGAAAAGG - Intergenic
1090988622 11:131795959-131795981 CAGATGGGAGGAAGGGAAAAAGG + Intronic
1091836891 12:3592368-3592390 CATAAGGACATAAGGGAGAAGGG + Intronic
1092042269 12:5395365-5395387 AAGAAGGAGTGAAGGGATCAAGG - Intergenic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093474113 12:19535709-19535731 CAGATAGAGTGAAGGGAAAGAGG + Intronic
1093566352 12:20609594-20609616 AAGCAGTACTGAGGGGAAAACGG + Intronic
1093808231 12:23462329-23462351 TAGAGAGACTCAAGGGAAAATGG - Intergenic
1095378070 12:41555408-41555430 AAAAAAGAATGAAGGGAAAAAGG + Intronic
1095640168 12:44478122-44478144 TAGTAGGCCTGAAAGGAAAAGGG + Intergenic
1095696909 12:45154215-45154237 CAGAATGATTGAAGTGAAAAAGG + Intergenic
1096362699 12:51001906-51001928 CAAAAGGACTCAAGGGAAGATGG + Intronic
1096767018 12:53899452-53899474 ATGAAGGAAGGAAGGGAAAAAGG + Intergenic
1096828059 12:54294520-54294542 CAGAGGGACTGAAGAGGAGAAGG - Intronic
1097123895 12:56757744-56757766 CATAAGGACTGAAGGAAAAAAGG - Intronic
1097131352 12:56813000-56813022 TAGAAGAAATGAAGGGACAAAGG - Intergenic
1097351517 12:58554392-58554414 CAGAAGCACTCAAAGAAAAATGG - Intronic
1097766456 12:63532463-63532485 AAGAAGGAATGAGGAGAAAAAGG + Intergenic
1097825662 12:64172527-64172549 AAGGAGGACTGAAGGAAGAAGGG + Intergenic
1098058476 12:66534658-66534680 CAGAAGGAAGGAAGGGAGGAAGG - Intronic
1098080848 12:66784061-66784083 CAGAGGGACAGCAGGGAAAATGG + Intronic
1098095821 12:66954902-66954924 AAGAAGGACTAAAGGAAGAAAGG + Intergenic
1098827170 12:75310864-75310886 CAGAAGCACTAAAGGGCAAATGG + Intronic
1099975848 12:89544840-89544862 CAGGAGGTCTGCAGGGACAAAGG + Intergenic
1100292194 12:93227030-93227052 CAAAAAAACTCAAGGGAAAAGGG - Intergenic
1100397372 12:94196793-94196815 CAGGAGGACTAAATGGAACATGG - Intronic
1100448033 12:94679023-94679045 CAGAATGACTGCAGGGCAGAGGG - Intergenic
1100615350 12:96227331-96227353 CAGAAGAGATGATGGGAAAAAGG - Intronic
1100759044 12:97785957-97785979 CAGAAGGATGGAAGGGCACAAGG + Intergenic
1101012947 12:100470291-100470313 CAGAAAGAAAGAAGGGGAAAAGG - Intergenic
1102624178 12:114221075-114221097 AAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1102942530 12:116956339-116956361 CAAAAGGAATGAAGCAAAAATGG - Intronic
1103246733 12:119464363-119464385 AAGGAGGAAGGAAGGGAAAATGG - Intronic
1103408396 12:120692493-120692515 CAGAGGGACTGATGAGACAATGG - Intronic
1103855008 12:123961315-123961337 AATAAGGACTGGAGTGAAAAAGG + Intronic
1104301740 12:127570665-127570687 AAGAAGGAAGGAAGGAAAAAGGG + Intergenic
1104435994 12:128757065-128757087 AAGAAGGAAGGAAGGGAGAAGGG + Intergenic
1104578365 12:129989378-129989400 CAGAAGAGCGGAAGGGCAAAGGG - Intergenic
1105251715 13:18704770-18704792 AGGAAGGGCTGAAAGGAAAATGG - Intergenic
1105285102 13:18996950-18996972 CAGAAGGTGTGAAGGCAAGAAGG + Intergenic
1105572949 13:21621216-21621238 CAGAGAGACTGAATGGAAAATGG - Intergenic
1105947629 13:25203086-25203108 CAGAAGGAAGGGAGAGAAAATGG + Intergenic
1105966345 13:25388205-25388227 AAGAAGGAAGGAAGGGATAAAGG + Intronic
1106231977 13:27827417-27827439 TAGAAGAACTAAAGTGAAAATGG - Intergenic
1106373303 13:29158599-29158621 CAGAGAGACTGAAAGGAATAGGG + Intronic
1106580359 13:31012618-31012640 GAGAAGTTGTGAAGGGAAAAAGG + Intergenic
1106711766 13:32343451-32343473 CAGAATGACTTAGGGGCAAAAGG - Intronic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1107042484 13:35964171-35964193 CAGAAGTTCTGCAGAGAAAATGG - Intronic
1107730919 13:43348004-43348026 CGGACGGATGGAAGGGAAAAAGG - Intronic
1109217795 13:59609879-59609901 CAGGAGGACTGCAGGAAAAAAGG - Intergenic
1109710516 13:66152716-66152738 AAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1110651773 13:77950437-77950459 CAGGTGGGCTGAAGGGAGAAAGG + Intergenic
1110872660 13:80470509-80470531 CAGAAGGAAGGAAGGAAAGAAGG - Intergenic
1111446086 13:88347738-88347760 CGGAAGGAATGAGGGAAAAAGGG + Intergenic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1112394336 13:99014704-99014726 GAGAAGAACAGAAGGAAAAATGG + Intronic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113140675 13:107145873-107145895 CAGAAGGGCAGAAGAGAAAAAGG - Intergenic
1114254198 14:20987956-20987978 GAGAAGGAGAGAAGGGAGAAAGG - Intergenic
1114539655 14:23445519-23445541 AAGAAGGGCTGAAGTTAAAAGGG - Intergenic
1114668420 14:24395833-24395855 CAGTAGGCCTGAAAGGGAAAAGG - Intergenic
1114713782 14:24804162-24804184 CAGAAGGAAGGACGGGAAGAAGG - Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115414082 14:33111181-33111203 CAGAAAGCCTGAAGGGAGCAAGG + Intronic
1115440581 14:33430267-33430289 AAGAAGAACTGAAGGGAAGGCGG - Intronic
1115984041 14:39085086-39085108 CAGAAGGAGAGAGGGGATAATGG + Intronic
1116157259 14:41221662-41221684 CTGAAGGACTGAAGGGGAGGAGG + Intergenic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1116411617 14:44631116-44631138 AAGAAGGAAAGAAGGGAAAAGGG + Intergenic
1116419460 14:44716035-44716057 CAGAAAGACTATAGGGAACAAGG - Intergenic
1116530619 14:45968237-45968259 CAAAAGTTCTGAGGGGAAAAAGG - Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1116602421 14:46943244-46943266 CAAAAAGACTGAAAGGAAATGGG - Intronic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117247438 14:53900160-53900182 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117955524 14:61120586-61120608 CACAAAGAGGGAAGGGAAAAGGG + Intergenic
1118542421 14:66842649-66842671 CAGAAAAACAGAAGAGAAAAGGG - Intronic
1118556664 14:67031083-67031105 GAGAATGAATGAAGGGATAAGGG - Intronic
1118695323 14:68379389-68379411 CAGAGGGACTGCTGGGAGAAGGG + Intronic
1118978491 14:70697722-70697744 CACAAGGAGAGAAGAGAAAAAGG + Intergenic
1119467824 14:74873327-74873349 CAGAGAAACTGAAGGGGAAAAGG - Intergenic
1119742298 14:77021989-77022011 CAGAAGAAATGGAGGTAAAATGG + Intergenic
1119786072 14:77315220-77315242 CACAAGGACTAAAGGGAAAAGGG + Intronic
1119806900 14:77487992-77488014 CAGAAGGGCTGAGGGGATCAGGG + Intronic
1119969210 14:78950643-78950665 AAGAAGGAAGGAAGGAAAAAAGG + Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120149639 14:81019017-81019039 CAGAAGAAATGAAAAGAAAAAGG + Intronic
1120333256 14:83120718-83120740 CAGAAGGCATGTTGGGAAAATGG - Intergenic
1120387126 14:83860766-83860788 CAGAAGGAGGAAAGGCAAAAGGG + Intergenic
1120828660 14:88978421-88978443 AAGAAGAACTGAAGTGAAGAGGG + Intergenic
1120841649 14:89090898-89090920 CAGTAGGAATGAAGAGAAACAGG - Intergenic
1121108311 14:91295250-91295272 GAGAAGAACTGGAAGGAAAAAGG + Intronic
1121180574 14:91925744-91925766 CAGAAGCACTGACGGGCTAATGG - Intronic
1121343626 14:93119336-93119358 CAGAAGGCCAGAAGGAAGAATGG - Intergenic
1121436695 14:93925331-93925353 CAGAAGGCCTGGGGAGAAAAGGG + Exonic
1121846164 14:97173881-97173903 CAGAAGGAGTGAATGGGACATGG + Intergenic
1121990851 14:98555747-98555769 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
1122040412 14:98983849-98983871 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1122140828 14:99662032-99662054 GGGAAGGACAGAAGGGAGAAAGG - Intronic
1122190507 14:100039046-100039068 TATAAGAACTGAAGGGAAAAAGG + Intronic
1122253893 14:100462921-100462943 GAGAAGGGGAGAAGGGAAAAAGG - Intronic
1122253909 14:100462976-100462998 GAGAAGGGGAGAAGGGAAAAAGG - Intronic
1122253925 14:100463031-100463053 AAGAAGAAGAGAAGGGAAAAAGG - Intronic
1123056719 14:105574337-105574359 CACAAGGAATGAAGGGAATGGGG - Intergenic
1123081490 14:105697448-105697470 CACAAGGAATGAAGGGAATGGGG + Intergenic
1123894662 15:24816564-24816586 CAGAAGGAAGGAAGAGAAGAAGG - Intergenic
1124019878 15:25910319-25910341 GTCAAGGACTGAAGGAAAAAAGG + Intergenic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125121232 15:36161143-36161165 GAGAAAGACTGAAGGGAAGAAGG + Intergenic
1125460413 15:39901418-39901440 CTTAAGGGCTGAAGGTAAAATGG - Intronic
1125613279 15:40987324-40987346 CAGATGAACTGAAATGAAAAGGG - Intronic
1126148392 15:45499543-45499565 CAGAAGGACAGAAGGATAGAAGG + Intronic
1126904016 15:53345121-53345143 CACAATGACTGAATGTAAAATGG + Intergenic
1126951314 15:53884813-53884835 CAGTAGGAGTAAAGGGAAAGAGG - Intergenic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127755350 15:62086521-62086543 CAGAACGGCTGATGTGAAAATGG - Intergenic
1127795164 15:62431718-62431740 CAGAAAGAAGAAAGGGAAAATGG + Intronic
1128796788 15:70472235-70472257 CAGAAGGGCAGAAGAGAAAAAGG + Intergenic
1129902040 15:79158576-79158598 CAGAGGGACTGAAAGTAGAAAGG + Intergenic
1129994878 15:79996053-79996075 CAGCAGGACTAAATGGAAAAGGG - Intergenic
1130026029 15:80271255-80271277 CAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1130227033 15:82066811-82066833 GAGAAGGACTGAAGGACACAAGG + Intergenic
1130952932 15:88606230-88606252 AGGAAGGAAGGAAGGGAAAAAGG - Intergenic
1131021611 15:89103978-89104000 CAGAAGGCCTGAAGGTCACATGG - Intronic
1131627792 15:94142128-94142150 AAGAAGGAATGAAGGGAGGAAGG - Intergenic
1132213855 15:100048210-100048232 CAGCAGGACGGAAGGCCAAAGGG + Intronic
1132635182 16:940768-940790 CGGAAGTACTGCAGGGTAAAGGG + Intronic
1133717876 16:8466814-8466836 AAGAAGGAAGGAAGGAAAAAGGG + Intergenic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1134831163 16:17324213-17324235 GAAAAGGACAGAAGAGAAAAGGG + Intronic
1135087642 16:19487895-19487917 CAGAGGGAGTGAGGGGAAACGGG + Intronic
1135432063 16:22393194-22393216 CAGATAGACTGCAGAGAAAAGGG - Intronic
1135592790 16:23716633-23716655 GAGAAGGACTGTTGGGGAAAAGG - Intergenic
1135634753 16:24065080-24065102 CAGAAAGACTGAAAGGGAAAAGG - Intronic
1135658507 16:24273222-24273244 CAGAAGGACTGAATAAAAAATGG - Intronic
1135715351 16:24760077-24760099 TATAAGGACTGATGGGAAACAGG - Intronic
1135824265 16:25712690-25712712 CAGAAGCCATAAAGGGAAAAGGG + Intronic
1135922022 16:26659455-26659477 GAGAAGGATAGAATGGAAAATGG - Intergenic
1136039041 16:27563529-27563551 AAGAAAGACTGCAGGGAAGAGGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1137575664 16:49598463-49598485 CAGAAGCAGTGAAGGGAAACAGG + Intronic
1137723905 16:50644445-50644467 CATAAAGACAGATGGGAAAAGGG + Intergenic
1137869622 16:51937457-51937479 TAGAAGGAATGATGGGAAAAGGG + Intergenic
1137923887 16:52521213-52521235 AAGAAAGCCTGAAAGGAAAATGG + Intronic
1137936969 16:52644268-52644290 CAGGCCGACTGAAGGGAAAATGG + Intergenic
1138147912 16:54628653-54628675 CAGAAGGAAAGAAGGGAAGCAGG + Intergenic
1138232782 16:55351559-55351581 TAGAAGAACTGAAGGTAAAGAGG + Intergenic
1138347552 16:56329337-56329359 CAGGAGGACGGAAGGAAGAAAGG + Intronic
1138550305 16:57744140-57744162 CAGAAGCACAGCAGGGAAGAGGG + Intronic
1138641180 16:58388578-58388600 GATCAGTACTGAAGGGAAAACGG + Intronic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1140257536 16:73349824-73349846 AAGAAGGAAGGAAGGGAGAAAGG - Intergenic
1140286708 16:73609674-73609696 AAGAAGGAAGGAAGGGAAAGAGG + Intergenic
1140656433 16:77144962-77144984 CAGAAAGCCACAAGGGAAAACGG - Intergenic
1140828728 16:78731516-78731538 AAGAAGGAATGAAAGGAAAAAGG - Intronic
1140866434 16:79066483-79066505 CAGAAGGAAGGAAGGGGGAAGGG + Intronic
1140949082 16:79798470-79798492 CAGCCAGACTGAAGGGAAGAGGG - Intergenic
1141756231 16:85992918-85992940 AAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141756235 16:85992934-85992956 AAGAAGGACAGAAAGGAAGAAGG - Intergenic
1141756238 16:85992961-85992983 CAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141756243 16:85992985-85993007 CAGAAAGACAGAAGGGAAGAAGG - Intergenic
1141756246 16:85993009-85993031 AGGAAGGACAGAAGGGAAGAAGG - Intergenic
1141756249 16:85993025-85993047 CAGAAGGACAGAAAGGAGGAAGG - Intergenic
1141799574 16:86297725-86297747 GAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142408461 16:89904103-89904125 CAGGAGGACTGCAGGGGAAGCGG - Exonic
1143336757 17:6177259-6177281 CAGAAAGACTCAAGGGAAGAAGG + Intergenic
1143761787 17:9110061-9110083 CAAAAGGACAGCAGGGGAAAAGG - Intronic
1143968355 17:10773728-10773750 CTGAAGGAGTGAAGGTAAGATGG - Intergenic
1143987468 17:10927250-10927272 AAGATGGAATGAAGGGATAATGG - Intergenic
1143987563 17:10928112-10928134 CAGAAGGAATGAAGAAAAAAAGG + Intergenic
1144036593 17:11371377-11371399 CATAAAGAGTCAAGGGAAAAGGG - Intronic
1144267393 17:13584501-13584523 AAGAAGGAAGGAAGGAAAAAAGG + Intronic
1144285871 17:13773581-13773603 GAGAAGGAATGAATGAAAAAGGG + Intergenic
1144411080 17:15002413-15002435 AAGAGGGACTGAAAGGAACAGGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1146255542 17:31390069-31390091 CAGACGAACTGAAGGGTCAAAGG + Intergenic
1146563501 17:33891963-33891985 CACAATGTCAGAAGGGAAAATGG - Intronic
1147627295 17:41908362-41908384 CAGGAGGAATGAAGGGCCAAAGG + Intronic
1148039058 17:44691618-44691640 TAAAGGGACTGGAGGGAAAAAGG + Intergenic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1149209276 17:54285713-54285735 CAGAAAGGATGAAGAGAAAATGG - Intergenic
1150724419 17:67640091-67640113 CAGATGGACTTGAGGGAAACGGG - Intronic
1150784080 17:68148968-68148990 TAAAGGGAGTGAAGGGAAAATGG + Intergenic
1150918257 17:69458019-69458041 CAGAAGGAAGGAAGGAAGAAAGG - Intronic
1151032870 17:70761485-70761507 CAGGAGGATTGAATGCAAAATGG - Intergenic
1151048040 17:70944477-70944499 CAGAAGGAAAGAAAAGAAAAAGG + Intergenic
1151760963 17:76103094-76103116 CAGAAGGAGAGAAGGAAGAATGG + Intronic
1151788154 17:76286487-76286509 CTGAGGGACAGAAGGGAACAGGG + Intronic
1152641452 17:81451006-81451028 CGGAAGGACTGATGGGCAGATGG + Intronic
1152726931 17:81952173-81952195 CAGAAGGGTTGAAGGGAAGCAGG + Intergenic
1153687622 18:7562372-7562394 AAGAAGGAAGGAAGGGATAAAGG - Intergenic
1153956572 18:10101512-10101534 CAGAAGGAATGAAGGGAGAGGGG - Intergenic
1154009081 18:10560139-10560161 CAGACGGAATGAAGGAAACAGGG + Intergenic
1154018944 18:10645559-10645581 CAGAAGAAATGAAGGGATAGGGG + Intergenic
1154185271 18:12177663-12177685 CAGAAGAAATGAAGGGATAGGGG - Intergenic
1155028007 18:21959854-21959876 AAGAAGGACAGAAGGAAAGAAGG + Intergenic
1155293727 18:24366365-24366387 TAGAGGGGCTGAAGGGGAAATGG - Intronic
1155457912 18:26040729-26040751 CAGAAGCACGGAAGGCAAATAGG - Intronic
1155492869 18:26417320-26417342 CAGAAAGACAGTAGAGAAAAAGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156451128 18:37266968-37266990 CAGAAGGGCTGTGGGGAAAGGGG + Intronic
1156950447 18:42890462-42890484 CAGAAGGAAAGAAGGAAAAGAGG + Intronic
1157108429 18:44796937-44796959 CGGAAGTCCAGAAGGGAAAAGGG - Intronic
1157144253 18:45145207-45145229 AAGAAGGAATGAAGGAAGAAAGG + Intergenic
1157150007 18:45207303-45207325 GAGAAGGAAGGAAGGGAAAAAGG + Intergenic
1157788308 18:50506760-50506782 CACCAGGACTGAAGTCAAAATGG - Intergenic
1158028152 18:52928709-52928731 CAGAAGCACAGAAGGCAAGAGGG - Intronic
1158467392 18:57702964-57702986 TAGAAGGAAGTAAGGGAAAATGG + Intronic
1158667981 18:59449939-59449961 CAGAGGGGCTGAAGGGAACCAGG - Intronic
1158776720 18:60591199-60591221 AAGAAGGAGGGAAGGGAGAAAGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159337448 18:67088349-67088371 AAGAAGGAGGGAAGGGAAGAAGG + Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159553099 18:69917394-69917416 CAGAAGGAGGGAAGGAAAGATGG - Intronic
1159619313 18:70619263-70619285 CCCAAAGACTGAAGGGAAGAAGG - Intergenic
1159691055 18:71487775-71487797 AAGTAGGTCTGAATGGAAAAAGG - Intergenic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1160269585 18:77372319-77372341 AAGAAGGACTCAGTGGAAAAGGG + Intergenic
1160609530 18:80074465-80074487 AAGATGGGCTGAAGGGGAAATGG + Intronic
1161137522 19:2628707-2628729 CAGAGAGACAGAAGGGAGAATGG - Intronic
1161777804 19:6273259-6273281 CAGAAGGAGTGGCTGGAAAAAGG + Intronic
1162537734 19:11273607-11273629 AAGAAGGACAGAAGGAAAGAAGG - Intergenic
1163113980 19:15178348-15178370 CTGGAGGTTTGAAGGGAAAAGGG - Intronic
1164203041 19:23034103-23034125 AAGGAGGTCTGAAGAGAAAAAGG + Intergenic
1164829638 19:31310582-31310604 CAGAATGAATGCAGGGAAAGGGG + Intronic
1165280955 19:34796771-34796793 CAGGAGGTCTGAAGTTAAAAAGG + Intergenic
1165432043 19:35778432-35778454 CAGAGGGACAGAAGGGAGCAGGG - Intronic
1166223357 19:41379640-41379662 AAGAAGGAATGAAGGAAACAAGG + Intronic
1166374603 19:42320542-42320564 GAGAATGACTAAAAGGAAAATGG - Intronic
1166714957 19:44961070-44961092 CAGAATGACAGAAGGGAAGGGGG - Intronic
1166766137 19:45252717-45252739 CAGATTGACCCAAGGGAAAAGGG - Intronic
1167698392 19:51027901-51027923 CAAATGCACTGAAGGGAAACTGG - Intronic
1167699527 19:51034368-51034390 GAGAGGGACAGAAGGGAAGAGGG + Intronic
1167915003 19:52733754-52733776 GAGAAGGAATAAAGGGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
925527689 2:4821813-4821835 CAGAAGGTCTGATGGGAGAAGGG - Intergenic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
926557587 2:14377850-14377872 AGGAAGGAAGGAAGGGAAAAAGG - Intergenic
926627683 2:15106736-15106758 CACAAGGATTCAAGGGAAAATGG + Intergenic
926969330 2:18451398-18451420 CAGGAGGCCAGAAGGGAAACTGG - Intergenic
927083439 2:19652607-19652629 CAGCAGGATGGAAGGGGAAATGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927505728 2:23613338-23613360 TAGAAAGATTAAAGGGAAAAGGG + Intronic
927782638 2:25951918-25951940 ATGAAGGAGTGATGGGAAAATGG + Intronic
928237119 2:29553248-29553270 CAGAAGGGGCTAAGGGAAAAAGG - Intronic
928443939 2:31316437-31316459 CATGAGGCCTGAAGGGAACAGGG - Intergenic
928762920 2:34605833-34605855 CAGAAGGACAGAAGGGTTGAGGG + Intergenic
929172945 2:38949523-38949545 CAGAAGTAAGGAAGGGAAGAAGG - Intronic
929633782 2:43494330-43494352 CAGCAGGAATGAAAGAAAAAGGG - Intronic
930302699 2:49637427-49637449 TAGCAGGATTGAATGGAAAATGG - Intergenic
930361112 2:50381120-50381142 CAGAATGAATGAATGGAACATGG + Intronic
930447100 2:51487776-51487798 CAGAAGGATGGAAGAGCAAAAGG - Intergenic
931070630 2:58644766-58644788 CTGAAGGGTTGAAGAGAAAATGG + Intergenic
931264643 2:60649861-60649883 AAGAAGGAAGGAAGGAAAAAAGG + Intergenic
931974921 2:67632952-67632974 CAGCACAACTGAAGAGAAAAGGG + Intergenic
932259693 2:70316907-70316929 GAGAAGGAAGGAAGAGAAAAGGG - Intergenic
932907274 2:75767550-75767572 CAGAAAGACTGAATGAAGAAGGG - Intergenic
933031688 2:77336202-77336224 AAGAAGGAAGGAAGGGAGAAAGG + Intronic
933031699 2:77336263-77336285 AAGAAGGAAGGAAGGGAGAAAGG + Intronic
933600105 2:84320221-84320243 CAAAGGGACTGAAGGAAAGATGG + Intergenic
933629563 2:84640277-84640299 CATAAAGATTGAAGGGAAAAAGG - Intronic
935649002 2:105366237-105366259 GAGAAAGACTGAATGGAAATTGG + Intronic
935986768 2:108680879-108680901 CAGAAGGCCTGAACAGAAAGAGG - Intronic
936139206 2:109924532-109924554 CAGAAGGCCTGAACAGAAAGAGG - Intergenic
936205490 2:110446954-110446976 CAGAAGGCCTGAACAGAAAGAGG + Intronic
936501250 2:113068093-113068115 CAGGAGGAGTGAAGGGATAGAGG - Intronic
936604420 2:113935357-113935379 CTGAAGGAATCAAGGGGAAATGG - Intronic
937087935 2:119184118-119184140 CAGAAGGGTAGAAGGGAACAGGG - Intergenic
937170732 2:119864747-119864769 CAGAATGAATGTAGGGAAACAGG + Intronic
937355119 2:121193354-121193376 GAGAAGGTCTGCAGTGAAAAAGG - Intergenic
937619579 2:123970548-123970570 CAGAAGGAAAGAAAGGAAGAAGG + Intergenic
938265790 2:129927270-129927292 CAGAGGGAATGAAGCAAAAATGG + Intergenic
938678190 2:133660190-133660212 CATTTTGACTGAAGGGAAAAAGG - Intergenic
938818912 2:134933559-134933581 GAGAAGGAGTGAAAGGAATATGG + Intronic
938928027 2:136062099-136062121 CAGAAGGAAGACAGGGAAAATGG - Intergenic
939004374 2:136768117-136768139 GGGAAGGAATGAAAGGAAAATGG + Intronic
939212734 2:139197790-139197812 AAGAAGGAGTGTAGGGAAGAGGG + Intergenic
940251274 2:151679321-151679343 CAGAAGTAACGAAGGAAAAAGGG + Intronic
940346063 2:152630353-152630375 GAGAAAGACTGAATGGAAATAGG + Intronic
940787833 2:158001325-158001347 TAGAAGGCCTGATGGGACAAAGG + Intronic
941160150 2:162026388-162026410 TAAAAGGACTGAAGTGAAAAGGG - Intronic
941346953 2:164381382-164381404 AAAAAGGACTGAAGGCTAAAGGG + Intergenic
941600182 2:167533756-167533778 GAGAAGGACTGAAATTAAAAAGG - Intergenic
941673933 2:168324100-168324122 CAGCAGGTCTGAAGGGACCAGGG + Intergenic
941833212 2:169985745-169985767 AAGAATGACTGAGAGGAAAAGGG - Intronic
942250819 2:174046427-174046449 CAGAAGGGCAAAAGGCAAAAGGG + Intergenic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
943920044 2:193694713-193694735 GAGAAGGAGTGAGGGAAAAAGGG + Intergenic
944177642 2:196850682-196850704 CAGAAGGAAGGAAGGAAAAATGG + Intronic
944460590 2:199945569-199945591 AAGAAGGAATGAAGGGTATATGG - Intronic
944475195 2:200096447-200096469 AAGAAGGAAGGAAGGAAAAAAGG - Intergenic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945051413 2:205827717-205827739 TGGAGGGACGGAAGGGAAAATGG - Intergenic
946090926 2:217222595-217222617 GAGATGGATTGAAGGGAGAAAGG - Intergenic
946209814 2:218138376-218138398 CACAAGGACTGGAGGAAACATGG + Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947384823 2:229580532-229580554 CAGAATGAAGGAAGAGAAAAAGG + Intronic
947689050 2:232117720-232117742 CACAAGGACAGAAGAGGAAAGGG - Intronic
948615728 2:239197521-239197543 CAGAAGGAGAGAATGGGAAAGGG - Intronic
1168812876 20:717692-717714 CGGAAGGACAGAATGGAATAGGG - Intergenic
1169342366 20:4806047-4806069 CAGAAGGGGTGAAGGGGACAGGG + Intronic
1169388878 20:5173492-5173514 CAGAAATACAGAAGAGAAAAAGG - Intronic
1170320299 20:15089672-15089694 CAGCAGGACTCAAGGGCAAAGGG - Intronic
1170830484 20:19835153-19835175 AGGAAGGAATGAAGGGAAGAAGG + Intergenic
1171429694 20:25074417-25074439 TAGAAGCACTGAAGTAAAAATGG - Intronic
1171985608 20:31658857-31658879 CAGAAGGAAAGAAGGAAGAAAGG - Intergenic
1172084185 20:32366445-32366467 CAGAAGGACTAAAGGAAATGAGG + Exonic
1173001797 20:39110329-39110351 AGGAAGGACCGAAGGGAAAAAGG - Intergenic
1173358560 20:42318781-42318803 CAGAAGGATTTAAGGTAGAATGG - Intronic
1173469414 20:43311182-43311204 AAGAAAGAAAGAAGGGAAAAAGG + Intergenic
1173716501 20:45211510-45211532 AGGAAGGAAGGAAGGGAAAAAGG + Intergenic
1173761573 20:45565122-45565144 AGGAAGGAAGGAAGGGAAAAAGG + Intronic
1174415190 20:50361343-50361365 GGGAAGGACGGAAGGGAGAAAGG + Intergenic
1174695497 20:52552535-52552557 GGGAAGAACAGAAGGGAAAAAGG + Intergenic
1174931869 20:54825011-54825033 CAAAAAGAAGGAAGGGAAAAAGG - Intergenic
1175041633 20:56057670-56057692 TAGAAGGAAAGAAGGGAGAAAGG + Intergenic
1175157255 20:56979445-56979467 CAGAAGGACTGAAGGCAGTGTGG + Intergenic
1175474946 20:59265548-59265570 GAGAAGGAATGAAGGGAGGAAGG - Intergenic
1175615010 20:60390506-60390528 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
1176837242 21:13804656-13804678 AGGAAGGGCTGAAAGGAAAATGG - Intergenic
1177562827 21:22778874-22778896 CAGAAGGACAGAAAGCCAAAAGG + Intergenic
1178288837 21:31349289-31349311 CTGAAAGGGTGAAGGGAAAAGGG + Intronic
1179040462 21:37797852-37797874 AAGAAGAAATGAAGGGAAATGGG + Intronic
1179166528 21:38939392-38939414 GAGAAGGAATGAAGGGAAGGGGG + Intergenic
1179570893 21:42278447-42278469 CAGAAGTAATGAAGTTAAAATGG + Intronic
1179805415 21:43834245-43834267 CAGAAGGAAGGAAGTGAAATGGG - Intergenic
1179826830 21:43970905-43970927 CAGAAGAACAGAAGTGCAAAAGG + Intronic
1179989018 21:44936437-44936459 CAGGAGGAATGAGGGGCAAATGG + Intronic
1180106074 21:45618942-45618964 CCCAAGAACTGAAGGGAAATTGG - Intergenic
1180928579 22:19573505-19573527 CAGAAGGGCAGAAGGGCAGAAGG + Intergenic
1180928581 22:19573513-19573535 CAGAAGGGCAGAAGGCAGAAGGG + Intergenic
1181295007 22:21830741-21830763 CAGAAGGAATGAAGGAAATTGGG + Intronic
1182086701 22:27565778-27565800 CAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1182100706 22:27655648-27655670 TAGAAGGATGGAAGGGAAGAAGG + Intergenic
1182114663 22:27749162-27749184 CAGAAGGAAAGAGGGGAGAAGGG + Exonic
1182858657 22:33540189-33540211 GAGAAGGACTGCTGAGAAAATGG + Intronic
1183143418 22:35966508-35966530 CAGAATGACTAAAATGAAAAAGG - Intronic
1183696605 22:39427255-39427277 CATGAGGACTGAAGGGAATAAGG - Intronic
1184155865 22:42666579-42666601 AAGAAGGAAAGAAGGAAAAAAGG + Intergenic
1184177313 22:42795740-42795762 TGGGAGGACTGAGGGGAAAAGGG + Intergenic
1184487557 22:44789924-44789946 GAGACAGACTGAAAGGAAAAAGG - Intronic
1184512207 22:44940386-44940408 CAGGAGGACTGCATGGACAAGGG - Intronic
1184934441 22:47710411-47710433 AAGAAGGAAGGAAGGAAAAAGGG - Intergenic
1185004861 22:48269968-48269990 CAGAAGGGCTGAAGTGGGAAAGG + Intergenic
949807713 3:7973947-7973969 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
949840604 3:8315864-8315886 CAGGAGGGCTGAAGGCATAAGGG - Intergenic
949903280 3:8837646-8837668 CAGAGGGAGTGAGAGGAAAATGG + Intronic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
951477818 3:23127002-23127024 CAGAAGGAGAGAAGAGAGAATGG - Intergenic
951598770 3:24348562-24348584 CAGAAGGCCGCATGGGAAAAGGG - Intronic
951816892 3:26764007-26764029 AAGAAGGAAGGAAGGAAAAAAGG + Intergenic
952018942 3:28993673-28993695 CAGAAGGAATAAAGGGAGAGAGG - Intergenic
952138370 3:30450142-30450164 CAGAAGTATTTAAGGGTAAAGGG - Intergenic
952597136 3:35031783-35031805 TAGAAGGACAGAAGGCAATATGG + Intergenic
952708293 3:36402299-36402321 AAGAAGGAAGGAAGGGAAAAGGG + Intronic
953061986 3:39434976-39434998 CATAAGGGCTCAAGGGAGAAGGG - Intergenic
953175133 3:40543957-40543979 AAGAAGGACTCCAGGAAAAAAGG + Intronic
953202887 3:40793409-40793431 AAGAAGGAATGAAGGAAAAAAGG - Intergenic
953272656 3:41460515-41460537 CAGCAGGAATCAAGGGAGAAAGG - Intronic
953352333 3:42224667-42224689 CAATAGGACTGAAAGGAAAAAGG + Exonic
953685245 3:45072983-45073005 GAGAAGGAATGAAGGGATACGGG - Intergenic
953828761 3:46277435-46277457 CCCAAGGTCTGAAGGGGAAAAGG - Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
955889251 3:63632401-63632423 AAGAAGGAAGGAAGGGAAGAAGG + Intergenic
956223915 3:66934697-66934719 CTTAAGGAGTGAGGGGAAAATGG - Intergenic
956486022 3:69722713-69722735 AGGAAGGACGGAAGGAAAAAAGG + Intergenic
956970822 3:74523086-74523108 CAGAAGGAAGGAAGGAAGAAAGG - Intergenic
957041946 3:75342390-75342412 CAGCAAGATTGAAGGGAATATGG + Intergenic
957593792 3:82233985-82234007 AAGAAGGAAGGAAGGAAAAAAGG + Intergenic
957615419 3:82519960-82519982 CAGAAACAAAGAAGGGAAAAGGG + Intergenic
957958870 3:87224779-87224801 AAGAAGGACAGAAGGGTAAAAGG - Intergenic
959416227 3:106078934-106078956 AAGAAGGAATGAAGGAAAGAAGG - Intergenic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
960193933 3:114741910-114741932 CAGAAGGAAATCAGGGAAAATGG + Intronic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
960687900 3:120312450-120312472 CACAAAGAGGGAAGGGAAAAAGG - Intergenic
960737716 3:120798907-120798929 CAGAGGGAATGTGGGGAAAAGGG - Intergenic
960933647 3:122881028-122881050 CAGAAGGACTGAAGGAACTAAGG + Exonic
961590006 3:127971762-127971784 CAGATGGGCTGAAGGCAGAAGGG - Intronic
961961541 3:130860737-130860759 AGGAAGGAGTGAAGGGAAGAAGG - Intronic
962300526 3:134238454-134238476 CTGAAGGACGGAGGGGAAGAAGG - Intronic
962493020 3:135911753-135911775 CAGAAGGAGAGAAGAGAAAAGGG + Intergenic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963524462 3:146399689-146399711 CAGAAGGAAGGAAGGAAAGAAGG - Intronic
963928394 3:150976250-150976272 CAGAGAGACTGCAAGGAAAATGG - Intergenic
966483220 3:180435657-180435679 CAGAAAGACTCAATGGCAAAAGG - Intergenic
966564764 3:181364398-181364420 GAGAAGGAGGGAAGTGAAAAGGG + Intergenic
966699306 3:182828313-182828335 CAGAAGCACTGCAGAAAAAATGG - Intronic
967478499 3:189947703-189947725 GAGAAGGATTGGAGGAAAAAAGG - Intergenic
967516879 3:190380253-190380275 CAGAAGGAAGGAAGGAAGAAAGG - Intronic
967548743 3:190764436-190764458 CAGAAAGACTGAGGAGAATATGG - Intergenic
968593190 4:1469881-1469903 CAGATGTACTCAAGGTAAAATGG - Intergenic
969871424 4:10107332-10107354 CAGGAGGACTGCATTGAAAATGG - Intronic
970346006 4:15152788-15152810 GAAAAGGAGTGAAGGGAGAATGG - Intergenic
970365107 4:15350272-15350294 AAGAAGGAAGGAAGGGAAGAAGG + Intronic
970373875 4:15436389-15436411 GAGATGGACAGAAGGGGAAATGG + Intronic
970423745 4:15928184-15928206 CAGAGGGAGGGAAGAGAAAAAGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
970899221 4:21139352-21139374 CAGAAGTACTTCAGGTAAAATGG + Intronic
970948723 4:21727254-21727276 TAGAAGGACAGAAGAGAGAAAGG - Intronic
970949698 4:21740336-21740358 AAGAATGAATGAAGGGAGAAAGG - Intronic
971149389 4:24015037-24015059 CAGAAGGAAACAAGGAAAAATGG + Intergenic
971252277 4:24983359-24983381 CAAAAGGAGGGAAGGGCAAAGGG - Intergenic
971451144 4:26803189-26803211 CAGAATAACTGAAAGGGAAAAGG + Intergenic
971956598 4:33428024-33428046 AAGAAAGACTCAAGGGAAAATGG + Intergenic
972103163 4:35447552-35447574 AGGAAGGAAGGAAGGGAAAAAGG + Intergenic
972103206 4:35447740-35447762 AGGAAGGAATGAAGGAAAAAAGG + Intergenic
972489519 4:39573800-39573822 CACAAGGAGTGAAGGTACAATGG + Intronic
972914682 4:43860998-43861020 CAGAAGGGTGGAAGGAAAAAAGG - Intergenic
974251955 4:59395985-59396007 AAATAGGACTGCAGGGAAAAAGG - Intergenic
974267932 4:59609766-59609788 CAGAAGAAGTGATGTGAAAATGG + Intergenic
974407562 4:61495433-61495455 CAGAAAGAATGAAAGAAAAAAGG + Intronic
974837289 4:67266243-67266265 CAGAAGGGCAGAAGGACAAAAGG + Intergenic
974971233 4:68830851-68830873 GAAAAGGAAAGAAGGGAAAAAGG + Exonic
975818137 4:78241075-78241097 CATAAGGAGTGAATGGAAAGTGG + Intronic
976019731 4:80606997-80607019 CAGAAGGAAGGAAGGGAGAGAGG + Intronic
976329687 4:83815098-83815120 AAGAAGGAGTCAAGGGACAAAGG + Intergenic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
976960525 4:90966158-90966180 AAGAAGGAGTGAAGAGAAAGTGG + Intronic
977095786 4:92742363-92742385 AGGCAGGACAGAAGGGAAAAGGG - Intronic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978122506 4:105097519-105097541 CAGAAGTCCTTAAGAGAAAAGGG + Intergenic
978343699 4:107743129-107743151 TAGTAGGAATTAAGGGAAAATGG + Intergenic
978454051 4:108868616-108868638 AAGAAAGAAAGAAGGGAAAAGGG + Intronic
978890709 4:113823578-113823600 GAGAAGGATTGATGTGAAAAGGG - Intergenic
978961721 4:114687531-114687553 CAAAAAAACTGAGGGGAAAATGG - Intergenic
979138645 4:117145103-117145125 AGGAAGGAATGAAGGAAAAAAGG + Intergenic
979449912 4:120858632-120858654 CAGAGGGACGGAAGGTAGAAGGG - Intronic
979916344 4:126439242-126439264 CAGAAGCACTGAAATGAAAGAGG - Intergenic
980285225 4:130771500-130771522 AAGAAGGAATGTAGGGAAATGGG - Intergenic
981829233 4:148981206-148981228 ATGAAGGAAGGAAGGGAAAATGG - Intergenic
981843833 4:149144058-149144080 AAGAAGGAAGGAAGGGAGAAGGG - Intergenic
981890854 4:149734797-149734819 AAGAAGGAGTGAAAGGGAAAGGG - Intergenic
981957101 4:150491000-150491022 CAGAAGGGCTGCATGGAAAATGG - Exonic
982196544 4:152921617-152921639 AAAAAGGAAGGAAGGGAAAAAGG - Intergenic
982464876 4:155717761-155717783 CAAAATGAGTGATGGGAAAATGG + Intronic
982542253 4:156688603-156688625 TAGCAGGACTGAAGGGCACAGGG + Intergenic
982587920 4:157266112-157266134 AGGAAGGTCTGAAGGGAAAATGG + Intronic
982689548 4:158532472-158532494 CAGAAGGGGAGAAGGGGAAAAGG - Intronic
982923603 4:161306307-161306329 CAAAAGGGCAGAAGGCAAAAGGG + Intergenic
983012419 4:162563962-162563984 CAGAAGCAATGAATCGAAAATGG + Intergenic
983101423 4:163630875-163630897 CAGAAGAAATGCAAGGAAAAAGG + Intronic
983286131 4:165741898-165741920 ATGAAGGAAGGAAGGGAAAAAGG - Intergenic
983545466 4:168958720-168958742 TAGAATGGCTGAAAGGAAAAAGG - Intronic
983611846 4:169655173-169655195 CAGAAAGACTGAAAGTAAAGAGG - Intronic
983676765 4:170303589-170303611 CAGAAGTACTGATGGGAGGAAGG + Intergenic
983693276 4:170498603-170498625 AAAAAGGAATGAAGGGAAGAAGG + Intergenic
983773930 4:171583252-171583274 TAGAAGGACAGAAGAAAAAAAGG - Intergenic
983976218 4:173937225-173937247 CAGGAGGTAAGAAGGGAAAAAGG - Intergenic
984256965 4:177400869-177400891 GGGAGGGACTGAAGGGAAGATGG - Intergenic
984523765 4:180831696-180831718 GGGAAGGACGGAAGGGCAAAAGG + Intergenic
984538852 4:181011944-181011966 CAGAATGAGAGAAAGGAAAAAGG - Intergenic
984720800 4:182970878-182970900 GAGAAGGAAGGAAGGAAAAAGGG + Intergenic
984830480 4:183968128-183968150 CAGAAAGATGGGAGGGAAAAGGG - Intronic
984840681 4:184064772-184064794 CTGATGCACTGAAGGGACAACGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985993762 5:3584871-3584893 CAGAAGGAAGGAAGAGAAATGGG + Intergenic
986253496 5:6082435-6082457 GAGAAGGTCTGAAGAGAACAGGG - Intergenic
986648391 5:9940549-9940571 GAGAAGGACAGAAAGGAATAGGG + Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
986998566 5:13635410-13635432 AAGAAGGAAGGAAGGAAAAAAGG - Intergenic
987238146 5:15964606-15964628 CAGAAGGGTGGAAGTGAAAAGGG - Intergenic
987312824 5:16697380-16697402 CAGAAAGAAAGAAGGGAAAATGG + Intronic
987939669 5:24517389-24517411 CTGAAGAATTGAAGGGAAAGTGG + Intronic
988561252 5:32283607-32283629 AAGAAGGAATGAAAGGAAAAAGG + Intronic
989158807 5:38370548-38370570 CAGAAGGACAGCCTGGAAAAGGG + Intronic
989234722 5:39133418-39133440 AAGAAGGAATGAAAGGAGAAAGG + Intronic
989975148 5:50576820-50576842 CTGAAGGACTGAAAAGAAAAAGG + Intergenic
990618931 5:57539022-57539044 CAGAAGGAAGGAAGGAAAAAAGG + Intergenic
990686622 5:58310027-58310049 CAGAAGAAGTGAAGAGAAAAAGG - Intergenic
990760692 5:59126160-59126182 AAGAAGGAAGGAAGGAAAAAAGG + Intronic
990890216 5:60640698-60640720 CAGATGGGCTGAAGAGAAAGAGG + Intronic
991005073 5:61820904-61820926 CAGAAGGAGAGCAGAGAAAATGG + Intergenic
991324842 5:65419401-65419423 CAGAAGGAAGGAGGGGAGAAAGG + Intronic
991501816 5:67284346-67284368 CAGAAGGACAGATAAGAAAAGGG - Intergenic
992434582 5:76743120-76743142 CAGAAGGAATGGAGGAAATAAGG + Intergenic
993186702 5:84630948-84630970 GAGAAGGAACGAAGAGAAAATGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
993735069 5:91466515-91466537 AAGAGGGAAAGAAGGGAAAAAGG - Intergenic
994811830 5:104529157-104529179 CAGAAGGAAGGAAGGAAGAAAGG + Intergenic
994965748 5:106668878-106668900 AGGAAGGACAGAAGGAAAAAGGG + Intergenic
995041542 5:107593694-107593716 CGGAAGGATTAAAGTGAAAAAGG + Intronic
995775247 5:115718044-115718066 CAGAAGGACTGAAACAAGAAGGG + Intergenic
995870547 5:116739244-116739266 CACCAGGACAGAAGGGAAAGGGG + Intergenic
995947696 5:117669662-117669684 AAGAAGGACTGAAGGGAGAATGG - Intergenic
996017465 5:118556654-118556676 AAGGAGGGCGGAAGGGAAAAGGG - Intergenic
996315814 5:122159587-122159609 CAGAAGGCATGAAGAGACAAAGG - Intronic
996506315 5:124271198-124271220 CAGGAGGAGGGAAGGGAAAATGG + Intergenic
997247241 5:132360326-132360348 CTGAAAGACTGAGGGGAAAAGGG + Intergenic
997660917 5:135588995-135589017 CAGCATCACTGAAGAGAAAAAGG + Intergenic
997672460 5:135686721-135686743 AAGAATGAATGAATGGAAAAAGG + Intergenic
997835077 5:137185640-137185662 CAGAAGGAATGCAGAGAACATGG + Intronic
998575575 5:143311958-143311980 CAGAAGGGTTGACAGGAAAATGG - Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999406913 5:151314677-151314699 CAGCAGGACAGAATGGAAGAAGG + Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
999922204 5:156334060-156334082 CACAAGGCCTAAAGGGAACATGG - Intronic
1000192403 5:158924218-158924240 CAGAAAGACTGCAGGTGAAATGG - Intronic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001951951 5:175822536-175822558 AAGATGGCCTGAAGGGAAAAGGG + Intronic
1001972815 5:175970098-175970120 CAGAAGGACCGTAGGAAATAAGG + Intronic
1002244623 5:177873684-177873706 CAGAAGGACCGTAGGAAATAAGG - Intergenic
1002822474 6:738997-739019 GAGAAAGAAGGAAGGGAAAAAGG - Intergenic
1003475340 6:6476848-6476870 CAGAAGGACTGAGGGGATAAGGG + Intergenic
1003626895 6:7749396-7749418 AAATAGGAATGAAGGGAAAATGG - Intronic
1003907353 6:10714266-10714288 CAGAAGGAAAGAAGGAAATAAGG - Intergenic
1004252586 6:14034348-14034370 CAGAAGGAATGATTGGAACATGG - Intergenic
1004581697 6:16960658-16960680 CAGGAGTAAGGAAGGGAAAATGG - Intergenic
1004790338 6:19019017-19019039 AGGAAGGAAAGAAGGGAAAAAGG + Intergenic
1005555626 6:26979378-26979400 AAGAAGGAAGGAAGGAAAAAAGG + Intergenic
1005673631 6:28132266-28132288 CAGAAAGACTAAAGGTAAAAGGG - Intergenic
1006092675 6:31637220-31637242 GAGAAGGACCTAAGGGAAGAAGG - Exonic
1006228278 6:32559016-32559038 CAGAGAGACTGAAGGGAAAGAGG + Intronic
1006341688 6:33450770-33450792 GAGAAGGACTGAAAAGAAGATGG + Intronic
1006513562 6:34534138-34534160 AAGGAGGACTGAGGGGAAACAGG - Exonic
1006818213 6:36868015-36868037 CAGAAGGACAGAAAGGAGGAGGG + Intronic
1007318783 6:41011302-41011324 CAGAAGATCTGAGGGGAAATGGG + Intergenic
1007662972 6:43497729-43497751 CAGAGGGCCTGAGGGGAAAGCGG - Intronic
1007809245 6:44474534-44474556 CCGCAGGGCTGAAGGGTAAAGGG - Intergenic
1008666716 6:53724082-53724104 CAGAAGGACAGAAAAGAGAATGG + Intergenic
1009276579 6:61689313-61689335 CAGAACAACTCAAAGGAAAAAGG - Intronic
1009490125 6:64279756-64279778 CAAAAGGACAAAAGAGAAAAAGG - Intronic
1010248816 6:73687340-73687362 AAGAAAGACTGAAGGGAGGAAGG - Intergenic
1010473649 6:76261036-76261058 CAGAAGGGCAGAAGAGCAAAAGG - Intergenic
1011493065 6:87912463-87912485 CAGACAGACTGATGGGAAAGGGG - Intergenic
1011822798 6:91272655-91272677 AAGAAGGAAGGAAGGGAAAGAGG - Intergenic
1011973521 6:93260844-93260866 AAGAAGGAGTATAGGGAAAAGGG + Intronic
1012330031 6:97973744-97973766 CACCAGGACTGATGGGCAAAGGG - Intergenic
1012601075 6:101097661-101097683 CAGAAGGACTGGAGTGATAGTGG + Intergenic
1012848271 6:104417380-104417402 CAGAAAGTGTGAAAGGAAAAGGG - Intergenic
1013520466 6:110928184-110928206 AAGAAGGAATGAAGGGAAGGAGG - Intergenic
1013642830 6:112103882-112103904 CAGAAGATATGAAGGCAAAAAGG + Intergenic
1014026374 6:116651270-116651292 CAGAAGGATTGAAGGTAAACAGG + Intronic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1015820214 6:137252835-137252857 AAGAAGGAATGAAGGGAGAGAGG - Intergenic
1017667684 6:156736990-156737012 CAGGAAGACTGAAGCCAAAATGG + Intergenic
1018044775 6:159956133-159956155 GAGAAGGAAGGAAGGAAAAAGGG + Intergenic
1018362317 6:163084433-163084455 TAGAGGAACTGAAGAGAAAATGG + Intronic
1019157313 6:170047962-170047984 CAGAAGGACTGGAGGTTGAAGGG + Intergenic
1019850408 7:3550465-3550487 CAGAAGAGCTGAAGGTAAAGGGG - Intronic
1020214789 7:6181705-6181727 CAGAAGGAGAGAATGGAAAGTGG - Intronic
1020758673 7:12240194-12240216 CAGAATGAGCGAAGGGATAAAGG - Exonic
1021330674 7:19335222-19335244 GAGAAGGACGGAAGGGGAGAAGG - Intergenic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1021689746 7:23220553-23220575 CAAAAGGTCTGGAGTGAAAAGGG - Intergenic
1022054224 7:26712865-26712887 GAGAAGGAGTAAAGAGAAAAAGG + Intronic
1022224011 7:28344788-28344810 CAAATGGACTGAAAGTAAAAAGG + Intronic
1022763123 7:33379162-33379184 CAAAAGAACTGTAGGGACAAAGG - Intronic
1022869429 7:34460343-34460365 CAGCAGAACTGAAGGAAATAGGG + Intergenic
1023510458 7:40947053-40947075 CAGAAGTAGAGAAGAGAAAAAGG - Intergenic
1024272618 7:47654083-47654105 CAGCAGAACTGAAGGGCAAGAGG - Intergenic
1025170999 7:56756638-56756660 CAGATGGACTGATGGGAGTAGGG - Intergenic
1025255297 7:57380840-57380862 CAGAAGGGTGGAAGGGAGAAAGG - Intergenic
1025700878 7:63819060-63819082 CAGATGGACTGATGGGAGTAGGG + Intergenic
1026632405 7:72048792-72048814 GAGAAGGAAGGAAGGAAAAAAGG - Intronic
1028357151 7:89924734-89924756 AAGAAGGAAGGAAGGGAAGAAGG + Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1030934711 7:115571065-115571087 AAGAAGGAAAGAAGAGAAAAAGG - Intergenic
1031368380 7:120932712-120932734 TAAAAGGACTCAAGGGTAAAGGG + Intergenic
1031394828 7:121260869-121260891 CAGGAGGAAAGAAAGGAAAAAGG + Intronic
1033258669 7:139823374-139823396 AAGAAGGACTGAAGGAACAGAGG + Intronic
1033629040 7:143139296-143139318 CAGAAGGACAGAAGGGAGGGAGG + Intronic
1033864184 7:145668393-145668415 ATAATGGACTGAAGGGAAAAAGG + Intergenic
1033914764 7:146309859-146309881 AAGAAGGAAGGAAGGGAAAGAGG + Intronic
1034278746 7:149837308-149837330 CAGAGGGGCAGAAGGGCAAAGGG + Intergenic
1034862914 7:154615470-154615492 CACAAAAACTGGAGGGAAAATGG - Intronic
1036057780 8:5278383-5278405 AGGAAGGACTGAACAGAAAAGGG + Intergenic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037513534 8:19607552-19607574 CAGAAGGATTTACTGGAAAAGGG - Intronic
1037806489 8:22060485-22060507 CAGAAGGCCAGCCGGGAAAATGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038834053 8:31099086-31099108 GAGAAGGAAGGAAGGGAGAAAGG + Intronic
1039510651 8:38089389-38089411 AATAAAGACTGAAGGGAAGAAGG - Intergenic
1040654369 8:49488455-49488477 AAGAAGGAAGGAAGGAAAAAAGG + Intergenic
1040675915 8:49749751-49749773 AAGAAGGAAGGAAGGAAAAAGGG + Intergenic
1040884063 8:52240095-52240117 TAGAAAGGCTAAAGGGAAAATGG - Intronic
1041996280 8:64062634-64062656 TAGAGTGACTGAATGGAAAAAGG + Intergenic
1043377954 8:79671115-79671137 CAGAAGGCATGAAGGCAAAGGGG + Intergenic
1045148411 8:99373887-99373909 CAGAAGGAATGAAGAACAAAGGG - Intronic
1045542436 8:103099710-103099732 CAGCAGGGATGAAGGGAGAAAGG - Intergenic
1046494759 8:114998947-114998969 AAGAAGGAAGGAAGGGAAGAGGG - Intergenic
1046561428 8:115842704-115842726 GAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1046591494 8:116212660-116212682 CATATGGACTGACAGGAAAAGGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047120032 8:121892317-121892339 AAGACAGACTGAAGGGAAGATGG - Intergenic
1047184535 8:122620056-122620078 CAGAATGAAAGAAGGGAGAAGGG - Intergenic
1047420302 8:124702534-124702556 CTGAAGGAATGAAAGAAAAAAGG + Intronic
1047552234 8:125887374-125887396 GGGAAGGAGGGAAGGGAAAAGGG - Intergenic
1047996706 8:130343378-130343400 TAGGAGTAGTGAAGGGAAAAAGG - Intronic
1048209109 8:132440331-132440353 ATGAAGGACAGCAGGGAAAACGG - Intronic
1048250954 8:132866545-132866567 AAGAAGGATAGAAGGGAGAAAGG + Intergenic
1048503915 8:135003752-135003774 AAGAAAGACTGGAGGTAAAAGGG + Intergenic
1048601768 8:135925954-135925976 CAGCAGGACAGATGGGATAAGGG + Intergenic
1048684340 8:136886631-136886653 CAAAAGCATTGAAGAGAAAAAGG + Intergenic
1049125793 8:140786585-140786607 CAGGATGACAGAAGGAAAAAAGG + Intronic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1050032665 9:1402927-1402949 AGGAAGAACTGAAAGGAAAAAGG + Intergenic
1050276713 9:4008378-4008400 CAGAATGAGGGCAGGGAAAATGG - Intronic
1050522602 9:6517316-6517338 AAGTAGGACTGAAGAGGAAAGGG - Intergenic
1050948839 9:11562506-11562528 AAGAAGGAAGGAAGGGAGAAAGG - Intergenic
1050992231 9:12169318-12169340 CAGAAGGCCTGAAGTTAAAAAGG + Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052423156 9:28270225-28270247 CAGGCTGACTGAAGGGGAAAGGG - Intronic
1052598056 9:30586960-30586982 AAGCAGGACTGATTGGAAAAGGG + Intergenic
1053140554 9:35680098-35680120 CAGCTGGACTGGAGAGAAAAAGG - Exonic
1053379389 9:37636312-37636334 CAGAAGGACAGCAGGAAGAAGGG + Intronic
1054846969 9:69808323-69808345 CAGGAGGTCTGAAGTTAAAAAGG + Intergenic
1055002149 9:71463627-71463649 CAGAAGGAGAGAAGAAAAAATGG - Intergenic
1055101820 9:72473410-72473432 AAGAAGGACAGAAGGAAGAAAGG + Intergenic
1055421485 9:76148033-76148055 CAGAAGGACTGAATGAACTAAGG - Intronic
1055595047 9:77857519-77857541 AAGAAGGAAGGAAGGGAAGAAGG + Intronic
1055753880 9:79536300-79536322 CAGAAGGATGGAAGGACAAAAGG - Intergenic
1055939372 9:81635019-81635041 CAGAAGGAATGAAGGCTCAAAGG + Intronic
1056265520 9:84892994-84893016 GAGAAGGAAAGAAGGAAAAAAGG - Intronic
1056281157 9:85042315-85042337 CAGAAGGACTAGAAGGGAAAAGG - Intergenic
1057062429 9:92017569-92017591 CAGCAGGTGTGAAGGAAAAATGG + Intergenic
1057292897 9:93818534-93818556 AGGAAGGAATGAAGGGAAAGAGG + Intergenic
1057412738 9:94831967-94831989 CCAAGGGACTGAAGGGGAAAAGG + Intronic
1057515721 9:95718795-95718817 CAGAAAGACTAAGGGGAAATAGG + Intergenic
1058336976 9:103842134-103842156 CAGAAGGACTCAAGGGGCATTGG - Intergenic
1058785895 9:108386421-108386443 CAGAAGGAAGGAAGGGGGAAAGG + Intergenic
1059588899 9:115636304-115636326 CAAAAGCACAGAAGGGAGAATGG - Intergenic
1059626162 9:116068781-116068803 GAAAAGGACTTAAGGAAAAAAGG + Intergenic
1059918238 9:119128202-119128224 GGGAAGAAATGAAGGGAAAAAGG - Intergenic
1059965544 9:119610025-119610047 AAGAAGGAAGGAAGGAAAAAAGG - Intergenic
1060456898 9:123806808-123806830 AAGAAGGAATGAAGGAATAAAGG + Intronic
1061589998 9:131592016-131592038 CACGAGGACTGAAGGGCAAGAGG + Intronic
1185492486 X:528535-528557 GAGAAGGAAAGAAGAGAAAAAGG - Intergenic
1185801796 X:3017759-3017781 AAGAAAGAAAGAAGGGAAAATGG + Intronic
1185872445 X:3675159-3675181 CAGAGAGCCTGAAGAGAAAAAGG - Intronic
1185939341 X:4297989-4298011 CAGAAAGAATGAAGGGAAAAAGG - Intergenic
1186985633 X:15010772-15010794 AAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1187230240 X:17414921-17414943 CAGAAAGGCAGAAGAGAAAATGG + Intronic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187587869 X:20683973-20683995 AAGAAGGAGGGAAGGAAAAAGGG - Intergenic
1188066355 X:25665132-25665154 CAGAATGAATGAAGGGGAATAGG + Intergenic
1188566805 X:31535761-31535783 TAGAATGAATGAAGGGACAATGG - Intronic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1189952726 X:46248900-46248922 CTCAAGGTCTGAAGGGACAAGGG - Intergenic
1190071318 X:47282190-47282212 AAGAAGGATGGAAGGGAGAAAGG - Intergenic
1190467810 X:50744199-50744221 CAGAAGGGGAGAAGAGAAAAAGG - Intronic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191722958 X:64249833-64249855 CAGAAGAAGAGAAAGGAAAAGGG - Intergenic
1191851910 X:65591542-65591564 CAAAAGGAAAGAAGGGAAAGTGG - Intronic
1191915959 X:66201390-66201412 CAGAAGGAAGGAAGGCAGAAAGG - Intronic
1192207814 X:69107702-69107724 AAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1193721779 X:84995418-84995440 CACATAGACTGAAGGTAAAAGGG + Intergenic
1193741199 X:85219764-85219786 AAGAAGGAATGAAGGAAGAAAGG - Intergenic
1194769061 X:97878031-97878053 CAGATGGAGAGAAGAGAAAAAGG + Intergenic
1194804415 X:98309531-98309553 CATAAGGAATGAAGGGGACAGGG + Intergenic
1195355297 X:104033789-104033811 AAGAAGCTCTGAAGGTAAAACGG + Intergenic
1195671344 X:107472749-107472771 CAGAAGTGATAAAGGGAAAAAGG - Intergenic
1196314245 X:114204089-114204111 CAGAAAGACTGAAAGGGGAAAGG + Intergenic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1196417044 X:115482124-115482146 GGGAAGGACAGAAGGGCAAAAGG - Intergenic
1196573014 X:117285304-117285326 TAGAAGGGCCAAAGGGAAAATGG - Intergenic
1196739159 X:119009190-119009212 CAGAAGAACTGAAGGAACGAAGG + Exonic
1196834460 X:119801760-119801782 AAGAAGGAAGGAAGGAAAAAAGG - Intergenic
1197720684 X:129742567-129742589 GAGAAGCACAGAAGGGAAGAGGG + Intronic
1198130532 X:133690263-133690285 GAGGAGGAGTGAAGGGGAAAGGG + Intronic
1198133984 X:133728373-133728395 AAGAAGGAGTGAAGGAAAGAAGG + Intronic
1198225371 X:134640460-134640482 GGGAAGGACGGAAGGAAAAAGGG - Intronic
1198754384 X:139967662-139967684 CAGAAGATCTCAAGGGATAAAGG - Intergenic
1199052369 X:143252015-143252037 AAGAAGGAATGAATGGAACAAGG + Intergenic
1199598897 X:149528857-149528879 AAGAAGGAATGAAGGAAAAGAGG + Intronic
1200559678 Y:4686148-4686170 CAGAAGGAGTGAAGGAAGGATGG + Intergenic
1200957052 Y:8960152-8960174 AGGAAGGAAGGAAGGGAAAAGGG + Intergenic
1201550376 Y:15211777-15211799 AAGAAGGAAGGAAGGGAAGAGGG + Intergenic
1201738675 Y:17300263-17300285 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
1202234142 Y:22690679-22690701 CAGAAGGAAGGAAGGGAGAGAGG + Intergenic
1202242314 Y:22783941-22783963 AAGAAGGAAGGAAGGGAGAAAGG - Intergenic
1202309016 Y:23505487-23505509 CAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1202395300 Y:24417689-24417711 AAGAAGGAAGGAAGGGAGAAAGG - Intergenic
1202475485 Y:25252405-25252427 AAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1202561784 Y:26165101-26165123 CAGAAGGAAGGAAGGGAGAGAGG + Intergenic