ID: 999893192

View in Genome Browser
Species Human (GRCh38)
Location 5:156000917-156000939
Sequence CAGGGACCACACTTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 3, 2: 3, 3: 43, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999893184_999893192 30 Left 999893184 5:156000864-156000886 CCTAAGAATTTGCGTATGTAATA 0: 1
1: 0
2: 1
3: 51
4: 392
Right 999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG 0: 1
1: 3
2: 3
3: 43
4: 202
999893187_999893192 2 Left 999893187 5:156000892-156000914 CCAGGTGTTGCTGATGCTGCTGA 0: 2
1: 41
2: 310
3: 938
4: 2133
Right 999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG 0: 1
1: 3
2: 3
3: 43
4: 202
999893186_999893192 3 Left 999893186 5:156000891-156000913 CCCAGGTGTTGCTGATGCTGCTG 0: 7
1: 190
2: 610
3: 1259
4: 2189
Right 999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG 0: 1
1: 3
2: 3
3: 43
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999893192 Original CRISPR CAGGGACCACACTTTGAGGA TGG Intronic
900358182 1:2274774-2274796 CAGGGACCCCACTTTCTGGGTGG + Intronic
900359081 1:2279308-2279330 CAGAGACCACCCTCTGATGACGG + Intronic
900697084 1:4019212-4019234 GAGGAACCGCACTGTGAGGAGGG - Intergenic
901803611 1:11724053-11724075 TATGGAACACACTTTGGGGAAGG - Exonic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902767773 1:18628663-18628685 GAGGGACCACACTGTGGGCAAGG + Intergenic
903543238 1:24108412-24108434 CAGGGCCCCCAGTCTGAGGAGGG - Intronic
904957608 1:34298211-34298233 CATGGAGCGCATTTTGAGGAGGG - Intergenic
906487809 1:46245298-46245320 CAGGGAACAGAGTTTGAGGCAGG - Intergenic
907390206 1:54153145-54153167 CACCGACCACACTATCAGGAAGG + Exonic
912464926 1:109865619-109865641 CAGGCCCCACACTTAGTGGAGGG - Intergenic
916335707 1:163668969-163668991 CAGGGAGCAAACATTGAGGTGGG + Intergenic
917329524 1:173867831-173867853 CAGGGCCTACAAGTTGAGGATGG - Intergenic
919694907 1:200564367-200564389 CAGGGGCTACACTTTGGGCATGG + Intronic
922349291 1:224722565-224722587 CAGGGACCACACTTTGAGCAGGG + Intronic
922553912 1:226518693-226518715 CAGATACCTCACTTTGTGGAAGG + Intergenic
922932746 1:229403118-229403140 CAGGGACCACCCTGGGAGCATGG - Intergenic
923108804 1:230874931-230874953 CTGGGACCACACTTTGAAATTGG + Intergenic
1062918193 10:1258007-1258029 CAGGGTCCCCACTGTGTGGATGG - Intronic
1066047354 10:31604911-31604933 CAGGGAACACAGTTTGGGTATGG + Intergenic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1069074305 10:64021765-64021787 CAGTGACCACACTGTGACTATGG - Intergenic
1069557532 10:69407778-69407800 CAGGGGCCAGGCTCTGAGGAGGG - Intronic
1069874949 10:71556072-71556094 AGGGGACCACACTTTGGGGCTGG + Intronic
1069987640 10:72295418-72295440 GAGGGACCACACACAGAGGAAGG + Intergenic
1072626466 10:97115525-97115547 CAGGCACCACAGTCTGAGAAAGG + Intronic
1074908025 10:117882136-117882158 CACAGACCACACGTTGAGTATGG + Intergenic
1074967128 10:118501228-118501250 CTGTGACCACACTTCCAGGAGGG - Intergenic
1075419963 10:122293449-122293471 CAGGGGACACACATTGAAGAGGG + Intronic
1077445104 11:2587161-2587183 CAGTGGCCACACAGTGAGGAAGG - Intronic
1080231694 11:30023322-30023344 CAAGGACCATACTTGTAGGAAGG + Intergenic
1081557423 11:44178312-44178334 CAGGGACCATATTTTGATGTGGG + Intronic
1081577795 11:44330045-44330067 CAGGGACCACAGGCTGAGGCTGG + Intergenic
1082162684 11:48901463-48901485 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082175077 11:49049458-49049480 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082238738 11:49851271-49851293 CAGGGATCCCACGTTGAGGACGG + Intergenic
1082243406 11:49893056-49893078 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082657901 11:55873882-55873904 CAGGGATCCCACGTTGAGGACGG - Intergenic
1083150373 11:60788235-60788257 CATGGAACATACTTTGAGAAAGG + Intronic
1083177686 11:60961789-60961811 CATGAACCTCACTTTGAGAAGGG - Intergenic
1086690691 11:89786626-89786648 CAGGGATCCCACGTTGAGGACGG + Intergenic
1086697831 11:89864880-89864902 CAGGGATCCCACGTTGAGGAAGG - Intergenic
1086708331 11:89979608-89979630 CAGGGATCCCACGTTGAGGAAGG + Intergenic
1086715110 11:90053034-90053056 CAGGGATCCCACGTTGAGGACGG - Intergenic
1087692411 11:101336893-101336915 CAGGGAACACAGTGTCAGGATGG + Intergenic
1088844151 11:113650834-113650856 CAGGGACAGCACTTTGAGAATGG + Intergenic
1093873648 12:24323030-24323052 CAGAGACCACACTTAGATAAGGG - Intergenic
1094268966 12:28590223-28590245 TAGGGACCCCACTTTTAGGATGG - Intergenic
1097920512 12:65067694-65067716 CACGGACCTCACTGTGAGAAAGG - Exonic
1098461181 12:70734641-70734663 CAGGGACCACAAGTAGAGAAAGG + Intronic
1100040729 12:90314018-90314040 CAGAGCCAACACTTTGAGGGTGG + Intergenic
1102481030 12:113223362-113223384 CAGAGCCCACAGCTTGAGGAAGG + Intronic
1103523063 12:121549136-121549158 CAGGACCCACACTTTGTAGAAGG + Intronic
1103618498 12:122170996-122171018 CAGGGACCACGTTTTGAGTCCGG + Intronic
1104780676 12:131417916-131417938 CTTGGACCTCACTTTGAGGCTGG + Intergenic
1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1104984319 12:132587960-132587982 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1106184237 13:27394862-27394884 CTTGGACCACACTTTGAGAATGG + Intergenic
1109661014 13:65460342-65460364 CTTGGACCACACATTGAGGAAGG + Intergenic
1111442399 13:88296958-88296980 CACACACCACACTTTAAGGAAGG + Intergenic
1112241976 13:97691182-97691204 TAGGGAACACACTTTAGGGAAGG + Intergenic
1113685457 13:112279692-112279714 CAGGGACCAATCCTTCAGGATGG + Intergenic
1113686003 13:112282785-112282807 CATGGACCATACCTTCAGGATGG + Intergenic
1113686733 13:112286931-112286953 CATGGACCATACCTTCAGGATGG + Intergenic
1113686897 13:112287883-112287905 CATGGACCATTCTTTCAGGATGG + Intergenic
1113687586 13:112291793-112291815 CATGGACCATACCTTCAGGATGG + Intergenic
1113687675 13:112292302-112292324 CACGGACCATACCTTCAGGATGG + Intergenic
1113688850 13:112298899-112298921 CATGGACCATACCTTCAGGATGG + Intergenic
1113690024 13:112305425-112305447 CATGGACCATACCTTCAGGATGG + Intergenic
1115756976 14:36538250-36538272 CAGGGATCAAAGTTTGAGGAGGG - Intergenic
1117669996 14:58096801-58096823 CAGGAACCAGGCTTAGAGGAGGG - Exonic
1118060534 14:62133147-62133169 CATCGACCACACTTTGAGTTGGG + Intergenic
1118193741 14:63605258-63605280 CAGGGACCACAATTAGATGATGG - Intronic
1121311937 14:92940088-92940110 CAGGATGCCCACTTTGAGGAGGG - Exonic
1124232120 15:27954824-27954846 CAAGGTTCACACTTTGCGGAGGG - Intronic
1125410585 15:39401891-39401913 CAGGGACCACCATTAGAGGCTGG + Intergenic
1125504243 15:40257774-40257796 CAGGGAGGAGACGTTGAGGAGGG + Intronic
1125871498 15:43106098-43106120 CAGGGACGACACTTTTACGACGG + Exonic
1126697122 15:51335837-51335859 CAGGGACCAGACTCTGTGGGTGG - Intronic
1127809955 15:62557116-62557138 CTAGGAACACACTTTGAGCAAGG + Intronic
1128363164 15:66976844-66976866 CAGGGACAGAACTTTGAGCAGGG + Intergenic
1128607501 15:69047711-69047733 CAGAGCCCACTCTATGAGGAAGG - Intronic
1129034299 15:72640385-72640407 CAGGGACCACGCTTTGGAGAGGG - Intergenic
1129215583 15:74096831-74096853 CAGGGACCACGCTTTGGAGAGGG + Intergenic
1129391840 15:75224629-75224651 CAGGGACCACACTTTGGAGAGGG - Intergenic
1129732719 15:77941160-77941182 CAGGGACCACGCTTTGGAGAGGG + Intergenic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1129888578 15:79056045-79056067 CAGGGAGCACCCTCTGAGGCAGG + Intronic
1130098476 15:80873861-80873883 CAGGGAGCACACTGCCAGGATGG + Exonic
1131537965 15:93253365-93253387 CATGGACCACACTTTGAATATGG - Intergenic
1131794266 15:95998484-95998506 CAGGCACCACCACTTGAGGATGG - Intergenic
1132002719 15:98196277-98196299 CAAGGTCCACATTTTAAGGAGGG + Intergenic
1132506796 16:314165-314187 CTGGGACCTCCCTATGAGGAAGG - Intronic
1132557953 16:580718-580740 CAGGGACCCCACCCTGAGCAGGG - Intronic
1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG + Intronic
1132732249 16:1368144-1368166 CTGGGACCACACCATGAGGTGGG + Intronic
1133234886 16:4383145-4383167 CAGGGACTGCACGTTGCGGAGGG - Exonic
1134299783 16:12980052-12980074 AAGGAACCACACTTTGAGTAGGG + Intronic
1135610421 16:23861585-23861607 CACTGATCACATTTTGAGGATGG - Intronic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1136560480 16:31036193-31036215 CAGGGACCCCAGATTGAAGATGG + Intronic
1137869539 16:51936403-51936425 CAGGCACTACACTTTGGGGATGG + Intergenic
1138237079 16:55393151-55393173 CAGGAATGACAATTTGAGGAAGG + Intronic
1138244684 16:55458714-55458736 TAGGAACCACCCTTTCAGGATGG - Intronic
1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG + Intronic
1138541528 16:57690543-57690565 CAGGGACCACTCTGGGATGAGGG - Intergenic
1141783969 16:86185914-86185936 CAGGGACCACACTTTGAGTAGGG + Intergenic
1143866854 17:9929890-9929912 CTGTGAGGACACTTTGAGGAAGG - Intronic
1143925795 17:10368750-10368772 CACAGACCACACTTTGAGAATGG + Intronic
1144513080 17:15894335-15894357 CAGGGATCACATTTAGATGAGGG + Intergenic
1146437236 17:32861598-32861620 CAGGGACCACACTTTGCGGAAGG - Intronic
1146679439 17:34796430-34796452 CAGGGACTACCCTCTGAGGCTGG + Intergenic
1146722700 17:35134264-35134286 TGTGGCCCACACTTTGAGGAGGG + Intronic
1146912360 17:36657022-36657044 CAGAGACCACACATCTAGGAAGG - Intergenic
1149238344 17:54618860-54618882 CAGGGACCAAGCATTGGGGAAGG - Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1155153641 18:23141098-23141120 GAGTGGCCACCCTTTGAGGAGGG + Intronic
1155925841 18:31653767-31653789 CAGGTAACACACTTGGAGAAAGG - Intronic
1157475656 18:48021878-48021900 CAGGAACCCCATTTTGGGGAGGG + Intergenic
1157750827 18:50176590-50176612 CAGGGACCAAACTTTGATCAGGG - Intronic
1161572960 19:5040319-5040341 CAGGGAGCCCTCTCTGAGGAGGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1167174052 19:47853220-47853242 CAGGAACCACACTTTGAGAGTGG - Intergenic
1168346281 19:55651628-55651650 CCAGGACCACACGTGGAGGAGGG - Intronic
1168618680 19:57859013-57859035 CATGGCCCACCCTTTCAGGAGGG + Exonic
1168624826 19:57909655-57909677 CATGGCCCACCCTTTCAGGAGGG - Exonic
925647053 2:6045879-6045901 CAGGGCCCAGGCTTTGAGAAGGG - Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926577351 2:14596786-14596808 AAGGGTCCAGTCTTTGAGGAAGG + Intergenic
927114629 2:19888265-19888287 CAGGGTCCACATCTTGAAGAGGG + Intergenic
927495937 2:23551884-23551906 TATGGACCACATTTTGAGTAGGG + Intronic
928353625 2:30586724-30586746 CAGGGACAAGATGTTGAGGATGG - Intronic
929154614 2:38778227-38778249 CAGCAACCATGCTTTGAGGAAGG - Exonic
930036801 2:47090960-47090982 CAATGAGCAAACTTTGAGGAAGG + Intronic
931852728 2:66269144-66269166 CAGGTACCTCACTTTGTGCATGG - Intergenic
932688663 2:73894252-73894274 CTGGGACCACACTTTGTACAGGG + Intronic
934106751 2:88702129-88702151 CTGGGAGTACAATTTGAGGAGGG + Intronic
935226407 2:101056810-101056832 CAGAAACCACACTTCAAGGAAGG - Intronic
938109273 2:128553210-128553232 CAGGGACCAGAATCTGAGGAGGG - Intergenic
939886225 2:147684888-147684910 CAGGAACCACAGTCTGAAGAAGG + Intergenic
941575955 2:167230431-167230453 AAAGGCCCACATTTTGAGGAAGG - Intronic
944908826 2:204289326-204289348 AAGTCACCACACTTTGAGGAAGG - Intergenic
945405849 2:209447923-209447945 CAGGGACCATACTTTGGGAAGGG - Intronic
946153503 2:217791841-217791863 AATGGACCACATATTGAGGATGG + Intergenic
947438161 2:230091199-230091221 CTTGGACCACACTTTGAAGCCGG + Intergenic
948672565 2:239577911-239577933 CATGGAGCACACTTTGTAGATGG - Intergenic
1169604774 20:7304912-7304934 CAGGGACCACATCTAGATGAAGG - Intergenic
1170003843 20:11645229-11645251 CATGGATCACACTTTGAGTGAGG - Intergenic
1170626450 20:18033708-18033730 CACTGACCACCCTTTGAGTAGGG + Intronic
1171198026 20:23216480-23216502 TGTGGACCACACTTTGAGCAAGG - Intergenic
1173603273 20:44311020-44311042 CGGGGACAACTCCTTGAGGAGGG + Exonic
1173648637 20:44649500-44649522 CAGTGTCCACACCTGGAGGATGG - Intronic
1174467477 20:50729367-50729389 CAGAGACCACACTCTGATCATGG - Intergenic
1176128405 20:63486133-63486155 GAGGGACCCCACTTTGGGAATGG + Intergenic
1178623264 21:34194669-34194691 CACAGACCACACTTTGGGTAGGG - Intergenic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1180074049 21:45453767-45453789 TCGGGGCCACACTTGGAGGATGG - Intronic
1181384556 22:22534411-22534433 GAGGGACAAAACCTTGAGGACGG + Intergenic
1181542382 22:23580309-23580331 CAGGGACCAGAGGATGAGGATGG - Intergenic
1181918707 22:26302191-26302213 CGAGGACCACACTTTGAGTAAGG - Intronic
1182706533 22:32284576-32284598 CAGTCACCATACTGTGAGGAAGG - Intergenic
1182853768 22:33499331-33499353 CAGGGCCCATACTTTGAACAGGG - Intronic
1183086966 22:35492303-35492325 CAGGGAGCACACCTGGGGGAGGG - Intergenic
1184478261 22:44733244-44733266 CAGGCACCACACTTTGCAGTTGG + Intronic
1185117929 22:48948758-48948780 CAGGGTCCACTCTTTGTGGCGGG - Intergenic
950792731 3:15486377-15486399 CACAGACCTCACTTTGAGTAGGG + Intronic
950893446 3:16426068-16426090 CAGAGAGCAGACATTGAGGAAGG - Intronic
951414541 3:22407996-22408018 CAGGGAGAAGACTTTGAGGTGGG + Intergenic
952198993 3:31105942-31105964 CAGGGATCACAGATTGAGGATGG + Intergenic
953686665 3:45083271-45083293 CAGGAACCAGACTTTCAGAAGGG + Exonic
953772986 3:45792907-45792929 CATGGACCACACTTCAGGGAAGG - Intronic
955191086 3:56762178-56762200 CAGGTCCCTCACTTTGAGGTGGG - Intronic
961041801 3:123683190-123683212 CAAGGAGCACTCTTTGGGGACGG + Intronic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
962417242 3:135194168-135194190 CAGGCCCCACATTTTGATGAAGG + Intronic
963259992 3:143182651-143182673 CAGGGAACATATTTTGAGAAAGG - Intergenic
967805472 3:193711396-193711418 CAGGGCCCACACATTCAGGGAGG - Intergenic
968921191 4:3522960-3522982 CAGGGACCACACCCAGAAGATGG + Intronic
969973685 4:11074663-11074685 CAGGTACCACACTCTGGGTACGG - Intergenic
974877646 4:67717643-67717665 CAGAAACCACACTCGGAGGAGGG - Intergenic
974896510 4:67946499-67946521 CAGGGACAACACAATGAGAACGG + Exonic
975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978581387 4:110235241-110235263 CAGTGACCACAGTTTTAGCATGG - Intergenic
979596614 4:122541719-122541741 CAGGGACTACAGTTTGATGTTGG + Intergenic
980161879 4:129174254-129174276 CAGGAAGCACACTGTGATGATGG + Intergenic
980698327 4:136389822-136389844 AAGTGACCATATTTTGAGGATGG - Intergenic
985578751 5:685707-685729 CAAGGACCACACTCTGCAGATGG - Intronic
986729538 5:10624951-10624973 CAGGGACCCCACATTGAGGATGG + Intronic
987093680 5:14529640-14529662 CAGGGACCACATTCTGGGCAGGG - Intronic
989214445 5:38890178-38890200 CATAGACCACACTTTCAGCAAGG - Intronic
989325843 5:40193316-40193338 CAGAGACCAGACATTGAGGGTGG + Intergenic
989957676 5:50375189-50375211 CAGGCACTACTCCTTGAGGATGG + Intergenic
992983526 5:82202882-82202904 CAGGGACTACTCTTTGGGCAGGG + Intronic
994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG + Intronic
995687351 5:114785090-114785112 CGGGGTCCATCCTTTGAGGATGG - Intergenic
997674533 5:135702841-135702863 CCGGGAGCACCCTTTGAGAAAGG + Intergenic
997991137 5:138545148-138545170 CTGTGTCCACACTTTGAAGATGG + Intergenic
998790610 5:145762923-145762945 CTGGGGCCACACTTTGAGAATGG - Intronic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1001111767 5:168902560-168902582 TAGAGACCATACTTTGAGAACGG - Intronic
1001585719 5:172832892-172832914 TGTGGACCACAGTTTGAGGAGGG + Intergenic
1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG + Intronic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004381772 6:15138651-15138673 TAAGGACCACACTTTGGGTAGGG + Intergenic
1004771915 6:18793493-18793515 AATGGACCACATTTTCAGGAGGG + Intergenic
1011239076 6:85251537-85251559 AAGGATCCTCACTTTGAGGAAGG + Intergenic
1012255646 6:97028263-97028285 CAGGGACCACACCTTAAGTAGGG + Intronic
1016376131 6:143422359-143422381 CATGGGCCACACTTTGAGTAAGG - Intergenic
1018425247 6:163674025-163674047 CAAGGACAACACCTAGAGGATGG + Intergenic
1018549676 6:164981366-164981388 CAAGGAACTCACTTTGTGGAAGG + Intergenic
1019095716 6:169577501-169577523 AAGGGTCCACACGTGGAGGACGG + Intronic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1024604713 7:51014032-51014054 CAGAGGCCACACTGTTAGGACGG + Intergenic
1028451230 7:90985801-90985823 ACAGGACAACACTTTGAGGATGG - Intronic
1030154789 7:106443314-106443336 CAGAGACTACAGTATGAGGAAGG + Intergenic
1032527304 7:132588610-132588632 GAGAGAACACACCTTGAGGAAGG + Intronic
1034737284 7:153440773-153440795 CAGGGGCCACTCTGTGAGCAAGG - Intergenic
1035553187 8:545134-545156 CGGGGACCACACTGGGAGGAGGG - Intronic
1035913781 8:3597168-3597190 CAGGGGTCATACTTTGAGAAGGG + Intronic
1037899156 8:22677457-22677479 CAGGGCCCACCCTTTGCGGGTGG + Intergenic
1039456730 8:37712166-37712188 CAGGGAGAGCACTTTGAAGAGGG + Intergenic
1040599508 8:48870205-48870227 CGGGGCCCACGCTCTGAGGAGGG - Intergenic
1041194265 8:55384934-55384956 CAGGGACTCCTCTTTGAGAATGG + Intronic
1041966938 8:63689075-63689097 CAGGGACCACCCTGTGCTGATGG + Intergenic
1045542347 8:103098956-103098978 CAGGTGCCACTCTTGGAGGACGG + Intergenic
1047582108 8:126227243-126227265 CAGGGCCAGCACTTTGAGAATGG + Intergenic
1049118649 8:140713598-140713620 CAAGGACTACACTTTGAGAATGG + Intronic
1050434031 9:5590510-5590532 CAGGAACAACAGTTTGTGGATGG + Intergenic
1051419456 9:16875347-16875369 CCGAGACCATACTTTGAGGATGG - Intergenic
1052933071 9:34071699-34071721 CAGTGACTCCACTTTTAGGAAGG + Intergenic
1055599206 9:77897775-77897797 CAGGGGCCACAATGTGAGGCTGG + Intronic
1060184853 9:121558129-121558151 CAGGCACCACGCTTTGGGGCTGG - Intergenic
1061892792 9:133631541-133631563 AAGGGACCACACTGCCAGGATGG - Intergenic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1062667985 9:137687877-137687899 CAGAGACCACACCGTGAAGACGG - Intronic
1185676137 X:1850938-1850960 CATAGACCACACTTTGAGTAGGG + Intergenic
1187280406 X:17854436-17854458 CAGTGCCCCCACTTTGGGGATGG + Intronic
1189066048 X:37810364-37810386 CAGAAACCACACTTTGAACAGGG + Intronic
1190357396 X:49618446-49618468 CATGGTGCCCACTTTGAGGATGG + Intergenic
1191108493 X:56787614-56787636 AAGGGACCCCACTTTGGGGTAGG + Intergenic
1191374514 X:59914559-59914581 CAGAAACGACATTTTGAGGATGG + Intergenic
1192225816 X:69226994-69227016 CCTGGACCAGACTCTGAGGACGG + Intergenic
1192331828 X:70181933-70181955 CATGGACCAGACTGAGAGGATGG - Intronic
1195920252 X:109976542-109976564 CAGGGACCACACTTTGGACAAGG - Intergenic
1196929435 X:120666531-120666553 CATGGATCCCACTTTGAGGTAGG + Intergenic
1197446126 X:126553365-126553387 CAGAGACCTCAATTTGAGGAGGG - Intergenic
1197766437 X:130062100-130062122 TGGGGACCAAACTTTGAGGTAGG - Intergenic
1199341800 X:146687890-146687912 CAGGGACCAATCTTGGAGAAAGG - Intergenic
1199856825 X:151766058-151766080 CAGGGGACAGACTTTGAGGAGGG - Intergenic