ID: 999893283

View in Genome Browser
Species Human (GRCh38)
Location 5:156001896-156001918
Sequence CTCAAAAATATGTACTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999893278_999893283 -3 Left 999893278 5:156001876-156001898 CCCAAGCAGCTGGCCAGGCCCTC 0: 1
1: 0
2: 4
3: 38
4: 295
Right 999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG 0: 1
1: 0
2: 3
3: 32
4: 270
999893279_999893283 -4 Left 999893279 5:156001877-156001899 CCAAGCAGCTGGCCAGGCCCTCA 0: 1
1: 0
2: 5
3: 52
4: 381
Right 999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG 0: 1
1: 0
2: 3
3: 32
4: 270
999893274_999893283 30 Left 999893274 5:156001843-156001865 CCACTGAGGGTGAAGGGCTGACA 0: 1
1: 0
2: 0
3: 15
4: 192
Right 999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG 0: 1
1: 0
2: 3
3: 32
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999893283 Original CRISPR CTCAAAAATATGTACTTCTA AGG Intronic
904283257 1:29436317-29436339 CTCTTAAATATGTCCTTCCAAGG - Intergenic
907623609 1:56007585-56007607 GTCAAGAATATGTACTACAAAGG + Intergenic
907917447 1:58883927-58883949 TTCAAAAATATTTCCTTCTTTGG - Intergenic
908961455 1:69701206-69701228 CTCACTGATATGTTCTTCTAGGG - Intronic
909245477 1:73276510-73276532 CTTACAAATATGTTCTTTTATGG - Intergenic
909379331 1:74980022-74980044 CTCAAAATCATTTTCTTCTAAGG + Intergenic
911264170 1:95724142-95724164 CTCAGAAAGAAGTATTTCTAAGG - Intergenic
911509845 1:98798175-98798197 CCCCAAAATATGTACAACTATGG - Intergenic
911993979 1:104739032-104739054 CTCAAAATTATTTTCTCCTAAGG + Intergenic
916158767 1:161887590-161887612 GTGAAAAATATGTATTTCTAAGG + Intronic
916735291 1:167602043-167602065 CCCATACATATGTCCTTCTAAGG + Intergenic
916830045 1:168481466-168481488 CTCCAAACTATGGAGTTCTAAGG + Intergenic
917144210 1:171870676-171870698 CTCAAAATTATATTCTTCTGAGG + Intronic
917258810 1:173145279-173145301 CTCAAAACCATGCAATTCTATGG - Intergenic
917983624 1:180292399-180292421 CTCAAAAACATGAAATTCTTAGG - Intronic
918863714 1:189866789-189866811 CTTAAAAACATGTACCTCAAGGG - Intergenic
918903880 1:190464927-190464949 CTGAGAAATGTGTACTGCTAAGG + Intronic
919122837 1:193362413-193362435 TTCAGAAATTTGTACTTCAATGG - Intergenic
919787371 1:201268379-201268401 CTCAGGAATATGAACTTTTAAGG - Intergenic
920575343 1:207055354-207055376 CTCAAAAAAATGAACCTATAGGG - Intronic
921305038 1:213787821-213787843 CTCAATACACTGTACTTCTATGG + Intergenic
921816990 1:219575299-219575321 ATGAAAAATATCTACTTCAAAGG + Intergenic
923074182 1:230594656-230594678 CTCAAATATATGTAAATCTTAGG + Intergenic
924687054 1:246304437-246304459 CAGAGAAATATGTACTTTTATGG - Intronic
1063505807 10:6598572-6598594 CCTAAAAATATGTACAGCTATGG - Intergenic
1063753836 10:8983457-8983479 CTCAGAAAGATGTCCTTCTTGGG - Intergenic
1063852196 10:10205637-10205659 CTTAAAATTATGTTTTTCTAAGG + Intergenic
1068000143 10:51323979-51324001 CCCAAAGATATGTACTACTATGG - Intronic
1068317165 10:55361132-55361154 TTCAAAAATAGGTTATTCTAAGG + Intronic
1069209453 10:65737912-65737934 CACAAAAATGTGATCTTCTAGGG + Intergenic
1070265739 10:74900943-74900965 CTCAAGAATATATACTTTCATGG - Intronic
1072331286 10:94355041-94355063 CTCAATCAAATGTTCTTCTATGG + Exonic
1075298428 10:121298608-121298630 CTCAAATTTATGTATTTCTAGGG + Intergenic
1075627173 10:123971972-123971994 TTAAAAAATATGTACTTTTGAGG - Intergenic
1077668246 11:4135238-4135260 CTCACTAGTATGCACTTCTACGG + Exonic
1077824452 11:5789682-5789704 CTCAAAAATATTTGATTCTATGG - Intronic
1077880738 11:6347546-6347568 CTCAAAAGCATGCACTTCAAAGG - Intergenic
1079540915 11:21573633-21573655 GTCAAAATTATGTAGTTCAAAGG - Intronic
1079841185 11:25401279-25401301 ATTAAAAATGTGTACTTCTGGGG - Intergenic
1080260043 11:30339048-30339070 ATTAAAAATATGTAATTCCAAGG - Intergenic
1081004075 11:37711974-37711996 CTCAAATATAGTTACTTTTAAGG + Intergenic
1082184269 11:49160927-49160949 CTCAAAACTATGCAATTCCATGG - Intronic
1085406314 11:76265122-76265144 CTCAAAAGTATCTTCTTCTCTGG - Intergenic
1085860851 11:80233585-80233607 CTCAAAAACATGTAATTTTGTGG + Intergenic
1086474218 11:87153121-87153143 ATCAAAAATATGTAATTTGAAGG - Intronic
1088702128 11:112422785-112422807 AGCAAAAAGATGTACTTTTATGG + Intergenic
1091297514 11:134484201-134484223 TTCAGAAGTCTGTACTTCTAGGG + Intergenic
1093128963 12:15366627-15366649 CTCAAAAATAAGTATTAATATGG - Intronic
1093627652 12:21368940-21368962 TTCAAAAATATTTACTTCTCTGG - Intronic
1096284897 12:50290744-50290766 TACCAAAATATGAACTTCTAGGG + Intergenic
1098706706 12:73700941-73700963 CTATAAAATATGTCCTTCCATGG - Intergenic
1099383845 12:81989779-81989801 CCCAATAATATGTACTTATAGGG - Intergenic
1099440610 12:82694960-82694982 GTCAAAATTTTCTACTTCTAAGG - Intronic
1099487576 12:83247668-83247690 CTCAAAACTATATAATTCCATGG - Intergenic
1099804953 12:87507175-87507197 ATCAAAAATAATTAGTTCTATGG - Intergenic
1099913970 12:88868646-88868668 CTCAGATATATGTGCTTCAATGG - Intergenic
1101654125 12:106705142-106705164 AACAACAGTATGTACTTCTAGGG + Intronic
1103102483 12:118190931-118190953 CTCAAAAACATGTACAACCATGG + Intronic
1103675720 12:122654166-122654188 CTCAACAGTATTTACTTCTCAGG - Intergenic
1104603940 12:130173834-130173856 CTTTAAAATATGTATTTCTGTGG + Intergenic
1106000721 13:25720471-25720493 CTGATAAATGTATACTTCTATGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108442134 13:50465534-50465556 TTCAAAACTATATAGTTCTATGG + Intronic
1108781188 13:53836638-53836660 CTCAATAATATTTTATTCTATGG + Intergenic
1108936992 13:55894043-55894065 CTCAAAAGTATGTATTTATCTGG + Intergenic
1110047281 13:70845919-70845941 CTTAAAAATAAATACTTCCATGG - Intergenic
1110694257 13:78469140-78469162 TTCAACAAAATGCACTTCTATGG + Intergenic
1110890960 13:80697640-80697662 CTCAAAATTAAACACTTCTAGGG - Intergenic
1111639818 13:90953622-90953644 AATAAAAATATGTAGTTCTAGGG - Intergenic
1113381929 13:109812435-109812457 CTCATAAATATATACACCTACGG + Intergenic
1114715967 14:24825153-24825175 CCCAAACATATTTACTTATAGGG + Intronic
1115691209 14:35845667-35845689 CTCTTAAATATATACTTCTATGG - Intronic
1115870501 14:37795859-37795881 ATCAAAAATATAAACTTTTAAGG + Intronic
1115929464 14:38474752-38474774 CTCAACTATATGTGATTCTATGG - Intergenic
1116087431 14:40258359-40258381 CTTCAAAATGTCTACTTCTAAGG + Intergenic
1116142525 14:41016689-41016711 CTGAAGAATATTTACTTCTAAGG - Intergenic
1117825482 14:59697887-59697909 CTCAAAAAGATGTACTGTTTAGG + Intronic
1120675076 14:87412467-87412489 TTCCAAATTATGTACTTTTATGG - Intergenic
1125426057 15:39550575-39550597 CTCAAAAATATGAACTGTAATGG - Intergenic
1125454479 15:39843317-39843339 CTCAATCATATGTATTTCAAAGG + Intronic
1126270226 15:46807839-46807861 CTCAAAACTTTGAACCTCTAAGG - Intergenic
1126391174 15:48154428-48154450 CTCAAAAATTTCCTCTTCTATGG - Intronic
1127998251 15:64167819-64167841 CTCAAAAATGAGAACTTCCATGG - Exonic
1128717534 15:69919729-69919751 CCCAAAGATTTGTAATTCTAAGG - Intergenic
1131334871 15:91539266-91539288 CTCAACAATTTGGACTTCTAAGG + Intergenic
1134766226 16:16760556-16760578 CCCAAAGATTTGTACTTCTCAGG + Intergenic
1134921098 16:18117393-18117415 CTCAAGAATATGTCCTTTTCTGG + Intergenic
1134979824 16:18598655-18598677 CCCAAAGATTTGTACTTCTCAGG - Intergenic
1135589230 16:23693284-23693306 CTCAAAAATATATATATATAGGG + Intronic
1135595558 16:23739916-23739938 GTCTAAAATATGCACTTCTAAGG + Intergenic
1139037376 16:62963497-62963519 AACCAAAATATGTACTTTTAAGG - Intergenic
1139132170 16:64159584-64159606 CTCATAAATATGTACAACTTTGG - Intergenic
1139167926 16:64592170-64592192 TTCAAAGGTATGTACTTCCAGGG + Intergenic
1146537441 17:33665299-33665321 CTCAAAAGTATGTACTGATGGGG + Intronic
1146570387 17:33947493-33947515 CTCAAATATGACTACTTCTATGG - Intronic
1146987452 17:37233906-37233928 TTAAAAAATATGTAATTATAGGG - Intronic
1149120969 17:53163817-53163839 CTTAAATAGATGTGCTTCTAAGG + Intergenic
1149133629 17:53339061-53339083 CTCAAAATTATGCCCTTATATGG + Intergenic
1154137941 18:11796953-11796975 CTCAAAAATAAGTTCTGATAGGG - Intronic
1155370173 18:25090867-25090889 CTTAAAAATATATACTGCTATGG - Intronic
1157471913 18:47995327-47995349 CATAAAAATATGTACATATATGG - Intergenic
1157501505 18:48194012-48194034 CACAGAAATGTGGACTTCTAAGG - Intronic
1159167016 18:64716153-64716175 CACAAAAATAAGCAGTTCTAAGG - Intergenic
1159386333 18:67729822-67729844 ATTAAAGATATGTACCTCTAGGG - Intergenic
1159535922 18:69714605-69714627 CTAAAAAATATTTATTTTTATGG - Intronic
1160293713 18:77618438-77618460 TTCAAAAATATGTCCCACTATGG - Intergenic
1164699134 19:30270031-30270053 TTTAAAAATACCTACTTCTAAGG + Intronic
1165089943 19:33380241-33380263 CTCAAAAACTTGTACTTTTGGGG - Exonic
1165107669 19:33482805-33482827 CTGAAAAATATTTTTTTCTATGG - Intronic
1167804350 19:51769460-51769482 CTCAAAGAGATGTTGTTCTATGG + Exonic
1167869570 19:52356536-52356558 CTCAAAAATATATAAATCAATGG - Intronic
1167872109 19:52379196-52379218 CTCAAAAATATATAAATCAATGG - Intronic
929848726 2:45560635-45560657 CTCAAATATATCTACTTCTTAGG + Intronic
931371193 2:61664729-61664751 TTCAAAAATTTGTATTTCTTAGG + Intergenic
931945585 2:67302869-67302891 CACATAAATATGTACATATAAGG + Intergenic
932919659 2:75896654-75896676 CTCAAAAATCTGTAAATTTATGG + Intergenic
933100019 2:78243427-78243449 TTCAAAAATATGAAATTCTGAGG - Intergenic
935544161 2:104383283-104383305 ATCAAAAATTTGTACTTCCAGGG + Intergenic
935561723 2:104566831-104566853 CTAAAGTAAATGTACTTCTATGG - Intergenic
937550010 2:123076225-123076247 TTCCAAAATACTTACTTCTATGG + Intergenic
937583619 2:123519484-123519506 CTCAAAAATATTTCCTACAAGGG + Intergenic
941209763 2:162623223-162623245 CTGACAAATATTTGCTTCTAAGG - Intronic
941835005 2:170006517-170006539 CTCAAAAAAAGTGACTTCTAAGG - Intronic
941836756 2:170030641-170030663 CATTAGAATATGTACTTCTAGGG + Intronic
942191532 2:173475303-173475325 CTCAACAATATGTACTAGAAAGG + Intergenic
942583789 2:177451284-177451306 CCAAAAAATATGTACTACTTAGG - Intronic
943585858 2:189739367-189739389 TTCATAAACATGTAATTCTATGG - Intronic
944381810 2:199119159-199119181 CACAAAAATCTGTATTTATAAGG - Intergenic
944385371 2:199157655-199157677 CTCAAAACTATACACTTTTATGG + Intergenic
944914407 2:204343522-204343544 CTCAATAATATTTAGTTGTATGG - Intergenic
945131035 2:206572436-206572458 CATAAAATTATGTAATTCTATGG - Intronic
945270414 2:207933036-207933058 CTCAAAAATAATTGCTTATAAGG - Intronic
945748590 2:213751150-213751172 CTAAAGAAAATGTACTTATATGG + Intronic
946127185 2:217573275-217573297 CTCAAAAAAATGGAGTTCAAAGG - Intronic
946531305 2:220573417-220573439 TTCAACAATATATACTTCAAAGG - Intergenic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1171245207 20:23605334-23605356 CTTCAAAATAAGGACTTCTAAGG - Intronic
1171356729 20:24552060-24552082 ATCAGAAATATTTACTTTTAGGG + Intronic
1173106049 20:40135022-40135044 CTCAAACATATATACTTATGTGG - Intergenic
1173109382 20:40171562-40171584 CTCAAAAATTTGTAATTCACTGG + Intergenic
1173807020 20:45932876-45932898 CTCAAAAAAAAGTACTGCTTTGG - Intergenic
1174599267 20:51711218-51711240 CTTAAAAATATGCACATCTCTGG - Intronic
1174744020 20:53043894-53043916 CTCAAACATCTGTACTTCGCTGG + Intronic
1174855623 20:54042601-54042623 CTGTAAAGTATTTACTTCTAAGG + Intronic
1174948937 20:55022374-55022396 TTTAAGAATATATACTTCTATGG - Intergenic
1177053297 21:16266476-16266498 CTCAAAAATATGTAATAATAAGG + Intergenic
1178396337 21:32246872-32246894 CTCCAAAATATGTGCTGCTTTGG + Intergenic
1179213399 21:39346610-39346632 CTTCAAAATATTTAGTTCTAGGG + Intronic
1181497232 22:23294399-23294421 CTCAAAAAAAGATATTTCTATGG - Intronic
1184377399 22:44123355-44123377 CTCAAAATTATGTACCTCAAAGG - Intronic
949100629 3:140435-140457 TTTAAAAGTATTTACTTCTAGGG - Intergenic
949424861 3:3906212-3906234 CTTAAATTTATTTACTTCTAGGG - Intronic
951614347 3:24524669-24524691 CTCAAAGAGAAGTACTTGTAGGG - Intergenic
951627144 3:24678117-24678139 TTCAAAAATATATTCTTCTCTGG - Intergenic
951976147 3:28511482-28511504 TCTAAAAATATGTACTTCAATGG - Intronic
952461087 3:33526829-33526851 CTCAAAAACATGCAATTATATGG + Intronic
952928230 3:38337958-38337980 CTCAAACATTTGTCCTGCTATGG + Intergenic
953245081 3:41183559-41183581 CTCAATAATAGGTATTTCTGAGG - Intergenic
954273102 3:49524679-49524701 CTCAAAAAAATGTATATTTAAGG + Intronic
955762957 3:62308457-62308479 CTCAAAAATATATAATTTTATGG - Intergenic
957002669 3:74904598-74904620 CTCAAAAATATGTATTAGTTAGG + Intergenic
957358559 3:79124100-79124122 TTCACAAATATGAACTTCTTTGG + Intronic
958129950 3:89405614-89405636 CTCTAAAATATGTGGTTTTAGGG - Intronic
958779125 3:98520735-98520757 CTCAAAAAATTGTCCTTTTATGG - Intronic
959307667 3:104690202-104690224 TTCAACAATATGTACTTGTAAGG - Intergenic
959855061 3:111143543-111143565 CTTATAAATATGTATTTATATGG + Intronic
960387677 3:117039519-117039541 CTCAAATATTTGGACTACTAAGG + Intronic
960390169 3:117068036-117068058 CTCAAAAATATCTACTTATTGGG - Intronic
960513056 3:118572813-118572835 CTCTAAAATATGAAATTCTTAGG + Intergenic
965364452 3:167781342-167781364 TTCAAAAATATCTACTTCAAGGG + Intronic
966858966 3:184217825-184217847 CTGAAAAATATGTGTTCCTATGG - Intronic
967047407 3:185750442-185750464 CTCTAGAATTTGTACCTCTAGGG - Intronic
968044123 3:195614102-195614124 ATCAAAAATATATACATCTTAGG - Intergenic
969946192 4:10785586-10785608 CACAAATATATGTACTGATATGG - Intergenic
969998784 4:11343027-11343049 CTCAAACATCTCTACTCCTACGG + Intergenic
970839826 4:20454552-20454574 ATCATAAATCTGTACTTCCATGG - Intronic
972083752 4:35186491-35186513 CTCAAAACTATGTAATTACATGG + Intergenic
973940507 4:55905268-55905290 CACAAAAAATTGTTCTTCTATGG - Intergenic
974386696 4:61209625-61209647 CTCAGAAATAAGTACTTAAAAGG - Intronic
974818035 4:67031395-67031417 CTCAAAAGTATTTACTTCACAGG + Intergenic
974977878 4:68914730-68914752 CTCAACAAAAAGTATTTCTAAGG + Intergenic
975920869 4:79385458-79385480 CTAAAAAAAATGTACCACTAGGG + Intergenic
976523845 4:86062919-86062941 CTCAGAAATATTTAATTGTAGGG + Intronic
978484422 4:109234868-109234890 CTGAAAAATATAAGCTTCTATGG - Intronic
978765688 4:112402872-112402894 CTCAAAAATATGATCTTTTTAGG - Intronic
979353975 4:119680881-119680903 CTCAAAAATACGTACTACATTGG + Intergenic
979650751 4:123127715-123127737 TTCAAAAATATTAACTTTTATGG + Intronic
980242483 4:130194475-130194497 ACCAAAAATATGTATTTATATGG - Intergenic
981009628 4:139912164-139912186 CTCAAAAACAAGCACCTCTATGG - Intronic
981997009 4:150986046-150986068 CTGTAAAAAATGTACTTTTAAGG - Intronic
983050118 4:163036642-163036664 ATCAAAAATATGTTCCTTTAAGG + Intergenic
983375313 4:166920098-166920120 TTCATAAATATGGACTTCCAGGG + Intronic
983802974 4:171959177-171959199 TTACAAAATATGTAATTCTAAGG + Intronic
984039318 4:174710220-174710242 CTCAATAAGCAGTACTTCTAAGG + Intronic
984335691 4:178386848-178386870 CTCATAATCATGTACTTATATGG + Intergenic
984515075 4:180727825-180727847 CTCTAAAATATTCACTTCTATGG + Intergenic
985138907 4:186818760-186818782 CTCAAAACTATGAACTACTTTGG - Intergenic
986791777 5:11168456-11168478 CTGAGAAATATGAAATTCTATGG - Intronic
986863773 5:11959807-11959829 TTCAATAATATGTAATTGTATGG - Intergenic
987458512 5:18177031-18177053 CTCTATAATTTGTACTTCTCTGG + Intergenic
987643703 5:20644004-20644026 ATCAAAACTATGTACATGTAGGG - Intergenic
987726244 5:21703601-21703623 TTTAAAAATATATATTTCTAAGG - Intergenic
988034268 5:25805497-25805519 CTCAAAACTATGTAATTACATGG - Intergenic
988043559 5:25918349-25918371 CTCAAAACTATGTAACTATATGG + Intergenic
989679067 5:44007942-44007964 TTAAAAAATGTGTACTTCAAAGG - Intergenic
990048564 5:51466382-51466404 CTCAAAAATACCTACTACTATGG - Intergenic
990088284 5:52006583-52006605 CTCATAAATATGGACTAATATGG - Intergenic
990141890 5:52714527-52714549 CTCATAAATATGGACTTCGTAGG + Intergenic
992224506 5:74606969-74606991 CTCAGGAATATGTACTAATATGG - Intergenic
993077796 5:83256158-83256180 ATCAGAAATCTGTACTCCTAAGG - Intronic
993495723 5:88606600-88606622 TTCAAAATAATCTACTTCTAGGG - Intergenic
993545298 5:89204355-89204377 CTCAAATATCTGTATTTCCAAGG + Intergenic
994631594 5:102294885-102294907 CTCTAAAATCTATATTTCTAAGG + Intronic
995876422 5:116794974-116794996 ATTATAAATATGTAGTTCTAAGG + Intergenic
995980928 5:118103353-118103375 CTCAAGAATTGCTACTTCTATGG - Intergenic
996265750 5:121537514-121537536 CTCAAAACCATGTAATTATATGG + Intergenic
996645503 5:125810493-125810515 CTCCAAAATATGTACTTCATTGG - Intergenic
998913831 5:146993241-146993263 CTCAAAAAAATTTTTTTCTAAGG - Intronic
998997138 5:147877882-147877904 TTCAAAAATACGTAATTGTAAGG - Intronic
999029280 5:148272529-148272551 TTCAAAAATATACACTTCTATGG - Intronic
999725476 5:154433455-154433477 CTCACAAAACTGTAATTCTAAGG - Intergenic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
999906509 5:156146605-156146627 CTCCAAACTTTGTTCTTCTATGG - Intronic
1000701022 5:164450238-164450260 GACAAAAATTTGTACTTTTAAGG - Intergenic
1001022735 5:168197398-168197420 CTCAAAGAGATGAAATTCTAAGG + Intronic
1004211103 6:13645328-13645350 CTCAAATATATGTATTTCAAGGG + Intronic
1004536524 6:16508460-16508482 GGCATAAATATGAACTTCTATGG + Intronic
1007186174 6:39974370-39974392 CTCCAAAATATGTAGTTATGGGG - Intergenic
1007685819 6:43666773-43666795 CTCAAATATATGTATATATATGG - Intronic
1007934325 6:45719616-45719638 CTAAAAAGTAGGTTCTTCTAAGG + Intergenic
1009417617 6:63433061-63433083 CTCCAAGATTCGTACTTCTAGGG + Intergenic
1010797681 6:80136617-80136639 ATTAAAAATATGTACTTTGAAGG + Intronic
1011038520 6:83003905-83003927 CACCAAAATGTGTACATCTAGGG - Intronic
1011272377 6:85593011-85593033 CTCAAAAATAAAAAATTCTAAGG + Intronic
1012272239 6:97227810-97227832 CTTAAGAACATGTACTTCAAAGG + Intronic
1014248219 6:119090179-119090201 CTCAACAATGTGTCCTTCAATGG - Intronic
1014436664 6:121428089-121428111 CTCCAAAATATGTACAACTAAGG + Intergenic
1014462767 6:121717460-121717482 CTCAAAAAAATGTATTTCTTAGG + Intergenic
1014917767 6:127173543-127173565 CTAAAAAAAATGTATTTCAAAGG + Intronic
1019830803 7:3327561-3327583 CTGAAAAATATTTTCTTATATGG - Intronic
1020583843 7:10040054-10040076 GTCAAATATATTTAATTCTATGG + Intergenic
1021283101 7:18745126-18745148 CTCAGAAACATGGACTTATAGGG - Intronic
1022401719 7:30044868-30044890 CTAAAAAATATATACTTCTTTGG + Intronic
1022461826 7:30616340-30616362 CTCAACAGTATGTACTACTTTGG + Intronic
1023631145 7:42165439-42165461 TTCAGGAATATGTATTTCTAAGG - Intronic
1024773410 7:52753775-52753797 CTCAAAAATATATACTTTCTTGG - Intergenic
1028156264 7:87433352-87433374 CTCACAAATATTTACTTATATGG + Intronic
1028203017 7:87984666-87984688 ATCAAATATATAAACTTCTAGGG + Intronic
1028300985 7:89200568-89200590 GTCAACAATATTTACATCTATGG - Intronic
1030839332 7:114328783-114328805 ATCAAAAATATGGACTTTAATGG - Intronic
1030948320 7:115755917-115755939 CTTAACCATAGGTACTTCTATGG - Intergenic
1031452045 7:121934001-121934023 TTAAAAAATATGTATTTATATGG + Intronic
1031517477 7:122719003-122719025 CTCAAAATTGTGTACATTTATGG - Intronic
1031523956 7:122801152-122801174 CTCAAAAATATGTACATATAGGG + Intronic
1034219807 7:149435169-149435191 CTCAAAAATATGTACATATATGG - Intronic
1037105504 8:15102197-15102219 CTGAAAAATATTTAATTGTATGG - Intronic
1037692278 8:21192000-21192022 CTTACAAATATGTATTTATATGG - Intergenic
1038949305 8:32396746-32396768 ATCAAAAATATGTACTATTTGGG - Intronic
1039058870 8:33557818-33557840 CTCAAAAATAAGAGCTTATAAGG + Intronic
1039661133 8:39468035-39468057 CCCAAAAATATCTCCTTCTAAGG - Intergenic
1040673483 8:49720723-49720745 CAGAGAAATATGTATTTCTAAGG - Intergenic
1042213150 8:66401807-66401829 CTCAACCATATGTAATTCTCTGG + Intergenic
1042861759 8:73321350-73321372 CTCCAAAAGATGAGCTTCTAAGG - Intronic
1042883343 8:73519606-73519628 CACAAAAAAATGTCCTTATAGGG + Intronic
1043210481 8:77508377-77508399 ACTAAAAATATGTATTTCTATGG - Intergenic
1043627562 8:82281487-82281509 ATCTAAAAGATGTACTTCAAGGG + Intergenic
1043951582 8:86315418-86315440 CTCAAAACTATGTAATTACATGG + Intronic
1044931508 8:97256426-97256448 CTCAATAATATTTAATTGTATGG + Intergenic
1047179855 8:122576654-122576676 CTTACCAATATGTACTTTTAGGG + Intergenic
1048917092 8:139195525-139195547 CTCAAAAATATGAGTTTCTGTGG - Intergenic
1049938881 9:525661-525683 CTCAAAAATATGAAATTCTACGG - Intronic
1051157282 9:14163828-14163850 CTTAAAAGTCTGTACTTTTAGGG - Intronic
1051212306 9:14757729-14757751 CTGAAAAATTCCTACTTCTATGG + Intronic
1051394370 9:16603511-16603533 CTCAAAATTATTTTCTTCAATGG - Intronic
1051460504 9:17307892-17307914 CTCAAAATTATATACAGCTACGG - Intronic
1051507002 9:17838439-17838461 CTCAAATGTGTCTACTTCTAGGG + Intergenic
1052184245 9:25571597-25571619 TCCAAAAATGTGTAATTCTAGGG - Intergenic
1052620542 9:30903180-30903202 CTCAAAAATTTGTACACCAAAGG - Intergenic
1052630942 9:31037970-31037992 CTTAAAAAAATGTACTTTTTTGG - Intergenic
1055666842 9:78561398-78561420 CTCAAAAACATGGCCTTCTTTGG - Intergenic
1055676109 9:78663227-78663249 ATGAAAAATACATACTTCTAAGG - Intergenic
1056002641 9:82233100-82233122 CTCAAAAAGATCTTCTCCTATGG + Intergenic
1056295322 9:85187437-85187459 CTCCAAAATATATACTTTAAAGG + Intergenic
1057570674 9:96202059-96202081 CTCAAAAATCTGTACCTCGAAGG - Intergenic
1057960219 9:99447893-99447915 CTCTCCAAAATGTACTTCTATGG - Intergenic
1058610075 9:106766100-106766122 CTCAAAAATGTTTACTTCTTAGG + Intergenic
1058671718 9:107365975-107365997 ATCAGAAAAATCTACTTCTAAGG + Intergenic
1059956427 9:119520787-119520809 CTCAAGAATATAGACTTCGATGG + Intronic
1060388128 9:123252637-123252659 GTCAAAAATCTATACTTCTTTGG + Intronic
1187486656 X:19710663-19710685 CTCATAGATATGTACGTATAGGG + Intronic
1187749457 X:22445913-22445935 CTGAAAATTATGTACTTTTAAGG - Intergenic
1188242238 X:27807519-27807541 CACAAAATTGTGTACATCTATGG + Intergenic
1188318724 X:28708910-28708932 CACAAAAATATATACTACTTGGG + Intronic
1188664258 X:32799805-32799827 TGCAAAAATAAGTACATCTAGGG - Intronic
1189373859 X:40451027-40451049 CCCCAAAATATGTACAACTATGG - Intergenic
1190689882 X:52904689-52904711 CTCACAAAGATGTCCTCCTACGG + Intronic
1190696101 X:52951103-52951125 CTCACAAAGATGTCCTCCTACGG - Intronic
1192631842 X:72783171-72783193 CTCATAAATGTCTACTTCTTAGG - Intronic
1192649867 X:72937630-72937652 CTCATAAATGTCTACTTCTTAGG + Intronic
1193506886 X:82355788-82355810 TTCAAAAATATATAATTCTTAGG + Intergenic
1193806401 X:86001097-86001119 CCCAAAAATATATACAACTATGG + Intronic
1194838124 X:98707493-98707515 TTTAAAAATATGTATTTCTTTGG + Intergenic
1194960760 X:100232734-100232756 GTCAAAAATATTTACTTAGAAGG - Intergenic
1198531325 X:137551383-137551405 CTCAACAATATTTACTGCTCAGG + Intergenic
1201705570 Y:16932995-16933017 GTCAGAAATATGTATTTCTGGGG + Intergenic
1201867751 Y:18673036-18673058 CTCAAAAACGTTTACTTCTGTGG + Intergenic