ID: 999894522

View in Genome Browser
Species Human (GRCh38)
Location 5:156015558-156015580
Sequence CCTGTTTACCAGACAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999894522 Original CRISPR CCTGTTTACCAGACAGAAAA AGG Intronic
902458792 1:16555273-16555295 CCTGGTCACCAGACAGAAATGGG - Intergenic
902493364 1:16852643-16852665 CCTGGTCACCAGACAGAAATGGG + Intronic
903151980 1:21416031-21416053 CCTGGTCACCAGACAGAAATGGG - Intergenic
903985472 1:27224478-27224500 CCTATTTACAAGATATAAAAAGG + Intergenic
905790054 1:40784782-40784804 CCTGTGTCCCAGACACAAAGAGG + Intronic
905905144 1:41612920-41612942 CTTGTTTGCCACACAGAAATGGG + Intronic
906022769 1:42645445-42645467 CTTGCTTACCAGACAGACTATGG - Intronic
906655614 1:47546269-47546291 CCTGTGTAGGAAACAGAAAAAGG - Intergenic
907414389 1:54304263-54304285 GCTGTTTACCATGCTGAAAAGGG + Intronic
908895758 1:68896751-68896773 CCTATTAACCAGACAGAAGTAGG - Intergenic
909472277 1:76041775-76041797 CATGTTTCAGAGACAGAAAAGGG + Intergenic
909626392 1:77720703-77720725 ATTGATTACAAGACAGAAAAAGG + Intronic
909814577 1:79975874-79975896 CCTATTTAACAGAAAGAAACTGG - Intergenic
913606853 1:120475112-120475134 CCTGGTCACCAGACAGAAATGGG + Intergenic
913988489 1:143586496-143586518 CCTGGTCACCAGACAGAAATGGG - Intergenic
914209580 1:145565030-145565052 CCTGGTCACCAGACAGAAATGGG - Intergenic
914268499 1:146057398-146057420 CCTGGTCACCAGACAGAAATGGG - Intergenic
914368593 1:147003465-147003487 CCTGGTCACCAGACAGAAATGGG + Intergenic
914584340 1:149046724-149046746 CCTGGTCACCAGACAGAAATGGG - Intronic
917069695 1:171136849-171136871 GATGTTTTCCAGACAGATAAGGG - Intergenic
917382370 1:174427441-174427463 CCTTTTTAAGAGACAGAAATTGG - Intronic
917787488 1:178474209-178474231 CCTTTCTTCCATACAGAAAAGGG + Intronic
920101067 1:203517314-203517336 CCTGCCCAACAGACAGAAAATGG + Intergenic
921893107 1:220372301-220372323 CATATTTACCAGAAATAAAAGGG + Intergenic
922424915 1:225483679-225483701 CCAGATTACTAGACAGAAAGTGG + Intergenic
1063438460 10:6053288-6053310 ACAGTTCACCAGGCAGAAAATGG + Intronic
1063514515 10:6681931-6681953 CCTGTTTTTCAGGCAGAAAGAGG + Intergenic
1066556257 10:36617488-36617510 CCTGTTTATTAAAAAGAAAATGG - Intergenic
1068110678 10:52676647-52676669 CCTGGGTAACAGACAGAAAAAGG + Intergenic
1068804770 10:61183190-61183212 CCTGTTTACCTGTCTGAAATGGG - Intergenic
1068860244 10:61840634-61840656 CCTCTTTACCTGACAAAAACTGG + Intergenic
1069651942 10:70055045-70055067 CCTGGGAACCAGACAGAAGATGG - Intronic
1070193812 10:74137951-74137973 ACTGTATACCACACAGAAAAGGG + Intronic
1071836714 10:89425456-89425478 TCTGTTTTTCAGAAAGAAAAAGG + Intergenic
1072160651 10:92763111-92763133 GCTGTTTTCCAAAAAGAAAAAGG - Intergenic
1072441270 10:95457799-95457821 CCTGTTTAGCAGACAGCCAAGGG - Intronic
1072603093 10:96950288-96950310 GCTGTTCACCACACAGGAAAAGG - Intronic
1073805956 10:107097952-107097974 ACTGTGTAACAGACATAAAATGG - Intronic
1074056321 10:109925461-109925483 CCTGTTTGCAAGATAAAAAAAGG + Intergenic
1074135031 10:110618536-110618558 CCATTTTACCAGAGAGGAAATGG - Intergenic
1075704708 10:124493562-124493584 GCTGTTTACCCGACAGACTATGG + Intronic
1079849574 11:25514543-25514565 CCAGTTTATCAGACAAAACAAGG - Intergenic
1080732382 11:34971553-34971575 CCTTATTAACAGACAGAAAAAGG - Intronic
1082200761 11:49364034-49364056 CCTGTAGAGCAGTCAGAAAAAGG - Intergenic
1083333381 11:61909414-61909436 CTTGGTTAACACACAGAAAATGG + Intronic
1084453604 11:69254575-69254597 TATGTTTACCAGACAGCCAAAGG + Intergenic
1086654915 11:89342193-89342215 CCTGTAGAGCAGTCAGAAAAAGG + Exonic
1088281738 11:108141679-108141701 ACAGTTTTCCAGAAAGAAAATGG + Exonic
1088685729 11:112283097-112283119 CTTGTGTAGCAGACAGAACATGG - Intergenic
1089050365 11:115540157-115540179 CTTGTTTTCCAGCCAGCAAATGG + Intergenic
1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG + Intronic
1089473892 11:118742961-118742983 ACTGTTTACCAGGGAGACAAGGG - Intergenic
1090609370 11:128456480-128456502 CCTGTATACAAGCCAGAGAAGGG + Intergenic
1090782251 11:130017881-130017903 TATGTTCATCAGACAGAAAAAGG + Intergenic
1097336071 12:58384442-58384464 AGAGTTTACAAGACAGAAAAAGG - Intergenic
1099069709 12:78030525-78030547 CATATTCACCACACAGAAAAGGG - Intronic
1099711689 12:86234527-86234549 ACTGTTTACCAGACACAGATTGG - Intronic
1100945743 12:99782087-99782109 TTTTTTTTCCAGACAGAAAAGGG - Exonic
1103208969 12:119153419-119153441 CCTGGCTTCCAGAAAGAAAAAGG + Intronic
1104431011 12:128716185-128716207 CCTCTTTGACAGAAAGAAAAAGG - Intergenic
1104453471 12:128890220-128890242 CGTGTTTTACAGACAGACAAGGG - Intronic
1107329379 13:39282529-39282551 CCTGTTTCACAGACAGCAATAGG - Intergenic
1107664894 13:42678624-42678646 CCTGAGGACCAGACACAAAAAGG - Intergenic
1108181505 13:47844600-47844622 GCTGTCTACAAGCCAGAAAATGG + Intergenic
1108440645 13:50449605-50449627 CCTGTTTCCCAGGAAGATAATGG + Intronic
1108935394 13:55875403-55875425 CCAGTTTACCAGAGAGAAGAAGG - Intergenic
1108996301 13:56738122-56738144 CCAAATTAACAGACAGAAAATGG + Intergenic
1109617186 13:64850918-64850940 CATTTTTACCTGAGAGAAAAGGG - Intergenic
1110266417 13:73542653-73542675 CCTGTTTTCCACACTGCAAAGGG - Intergenic
1111978945 13:94996967-94996989 TCTGTTTACAAGCCAGGAAAAGG - Intergenic
1114757329 14:25274236-25274258 CCAGTTCATCAGAGAGAAAAGGG + Intergenic
1116234437 14:42260274-42260296 CCTTTTTCTCATACAGAAAATGG - Intergenic
1116311594 14:43334191-43334213 CCTGTATGCCAGAGAGTAAAAGG - Intergenic
1116881302 14:50171869-50171891 CCTGTTTGCCAACCAGAAAAGGG - Intronic
1117072653 14:52069844-52069866 CTTGGTTACCAGGCAGAAAGGGG + Intergenic
1117495955 14:56304274-56304296 CCTGTTTAGAAGACAAAAGAAGG - Intergenic
1117602252 14:57388591-57388613 GCTTTTTAAAAGACAGAAAAGGG + Intergenic
1120076471 14:80164508-80164530 TCTGTTAACCAGAGAGGAAAGGG + Intergenic
1123042862 14:105497517-105497539 CCTGTTTTCCAGACAGGAAGAGG + Intronic
1123460238 15:20463769-20463791 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1123657824 15:22536648-22536670 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1124266459 15:28239498-28239520 CCTGCTAACCAGACAGCAGAGGG + Intronic
1124311733 15:28631846-28631868 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1124528461 15:30480260-30480282 GCTGTCTACCAGACAGGAAGAGG - Intergenic
1124770196 15:32527438-32527460 GCTGTCTACCAGACAGGAAGAGG + Intergenic
1126906559 15:53374132-53374154 CATGTGTACCAGAGAGATAAGGG - Intergenic
1127777751 15:62280743-62280765 CTTGTTAAGCAAACAGAAAACGG - Intergenic
1127843283 15:62848131-62848153 CCTGTTTCCTGGAGAGAAAAAGG + Intergenic
1129011726 15:72424416-72424438 CATGTTTACCACTCAGAAATTGG + Intergenic
1130170800 15:81511237-81511259 CCTGTTTCCCAGACTCTAAAAGG + Intergenic
1130318551 15:82818838-82818860 GCTGTCTACCAGACAGGAAGAGG - Intronic
1131343217 15:91622272-91622294 CCTGGTAATGAGACAGAAAATGG - Intergenic
1131344683 15:91635379-91635401 CATGTTTATCAGACAAAGAAAGG - Intergenic
1131731518 15:95287033-95287055 CCTGCCTACCAGACAGAAAGAGG + Intergenic
1132161347 15:99545822-99545844 CCTGCTTACCAGACAACAAATGG - Intergenic
1136704653 16:32176944-32176966 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1136763260 16:32752462-32752484 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1136804840 16:33117924-33117946 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1138054318 16:53816113-53816135 GATGCTCACCAGACAGAAAAGGG - Intronic
1138505929 16:57478301-57478323 CCTGGGTACCAGACAGAGCAGGG - Intronic
1139274891 16:65718516-65718538 CCTTTTTGCAAAACAGAAAATGG - Intergenic
1140051550 16:71485901-71485923 TCTGCTTACCAGAGGGAAAATGG - Intronic
1140389268 16:74571287-74571309 CATGTATACCAGAGAGATAAGGG + Intronic
1203065411 16_KI270728v1_random:1012784-1012806 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1143085941 17:4416207-4416229 CCATTTCACCAGACAGAAGAGGG - Intergenic
1144614752 17:16758524-16758546 CCTATTGAACAGAGAGAAAATGG + Intronic
1144845986 17:18219371-18219393 CCTGTTTTATAGACAGTAAATGG - Intergenic
1144897952 17:18557150-18557172 CCTATTGAACAGAGAGAAAATGG - Intergenic
1145134417 17:20388564-20388586 CCTATTGAACAGAGAGAAAATGG + Intergenic
1147240791 17:39089344-39089366 CTTCATTACCAGACAGCAAAAGG - Intronic
1147491656 17:40873574-40873596 TCTGTTTACCTGTCAGAAATAGG + Intergenic
1148194094 17:45700776-45700798 CCTCTTGACCAAACAGCAAATGG - Intergenic
1148821356 17:50361602-50361624 CCTGTTTACCCCTCAGAAAAAGG - Intronic
1155751746 18:29432574-29432596 CATGTTTACATGACATAAAATGG + Intergenic
1156290836 18:35747734-35747756 CCTGTTTACCACAGAGGGAAGGG - Intergenic
1157078779 18:44498589-44498611 AATCTTTACCAGAGAGAAAACGG + Intergenic
1157959586 18:52137915-52137937 CCAGTTTACCAGAGAGAATCAGG - Intergenic
1158099569 18:53815129-53815151 CTTCTCTACCAGACAAAAAATGG - Intergenic
1159413216 18:68108298-68108320 CCCTTTTAGCAGACAGAACATGG + Intergenic
1160403379 18:78628170-78628192 ACTGTTTACAACACAGAAATTGG - Intergenic
1160691817 19:463815-463837 CCTGTTTCCCACACAGTGAACGG - Exonic
1162396256 19:10419448-10419470 CCTGTTTACTCGCCTGAAAAGGG + Intronic
1163327938 19:16617274-16617296 CCTGTGTACCTGAAGGAAAATGG - Intronic
1164082472 19:21871542-21871564 TATGTTTACCAGAAAGAAAATGG + Intergenic
1164190096 19:22907127-22907149 TATGTTTACCAGAAAGAGAAGGG + Intergenic
1165317111 19:35063159-35063181 CCTGTTTTCCACCCAGGAAAAGG + Intronic
1166762314 19:45232595-45232617 CCTGTCTACCCCAGAGAAAAGGG - Intronic
1167869809 19:52358483-52358505 CCTGATTAACAAATAGAAAAAGG - Intronic
1202708741 1_KI270714v1_random:4860-4882 CCTGGTCACCAGACAGAAATGGG + Intergenic
927061349 2:19425257-19425279 ACTGTGTTCCAGACAGAAGAAGG - Intergenic
927655708 2:24943695-24943717 TCTGTTTACAAGACATAAACTGG + Exonic
929551888 2:42898876-42898898 CCTGATAACCAGAGAGCAAATGG - Intergenic
929581129 2:43082385-43082407 CCTGTTCACCAGGAAGGAAATGG - Intergenic
931059148 2:58506881-58506903 CCTCTCTACCAGACAGAAAAGGG - Intergenic
932118690 2:69078119-69078141 CCTGTTTACTATTCAGGAAAAGG - Intronic
932381256 2:71285400-71285422 CCTGTTTAAAAAAAAGAAAATGG - Intronic
933670465 2:85002636-85002658 CCTGGATCCCACACAGAAAAGGG - Intronic
934473757 2:94578670-94578692 CATGTTTGCCAGTGAGAAAAGGG + Intergenic
935738781 2:106128245-106128267 TCTGGTCACCAGACAGAACAGGG - Intronic
937428801 2:121821130-121821152 GCTCTTTACCAGATAGAAAATGG + Intergenic
939519371 2:143210299-143210321 CCTGTTTCCCAAACAGAACCTGG + Intronic
940892650 2:159049692-159049714 GCTGTTTACCAGACATGGAAGGG + Intronic
942506261 2:176644641-176644663 CCTAAAAACCAGACAGAAAATGG + Intergenic
942925187 2:181423896-181423918 CTTGTTTAATAAACAGAAAATGG - Intergenic
943953442 2:194158393-194158415 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
943966777 2:194344884-194344906 TCTGTTTAACAAATAGAAAATGG - Intergenic
944848738 2:203695362-203695384 CCAGAGTACCAGAGAGAAAAAGG + Intergenic
945072268 2:206003929-206003951 CCTGTATAAGAGACAGCAAATGG - Exonic
947001467 2:225461753-225461775 TCTGTTTAACAGACAGAATGAGG - Intronic
1173805210 20:45920367-45920389 CCTGTTCTTCACACAGAAAATGG - Intergenic
1173910538 20:46666323-46666345 CCTTTGTAACAGACAGAAAAGGG + Intronic
1175856995 20:62126448-62126470 GTAGTTTACCAGACAGAAACAGG - Intronic
1177665927 21:24159285-24159307 TGTGTTTTCAAGACAGAAAAGGG + Intergenic
1178962126 21:37074311-37074333 CCTGTTCAGGAGACAGAATAGGG + Intronic
1179078730 21:38149922-38149944 CCTGTTTAACAGAGAAAACATGG + Intronic
1179487178 21:41717763-41717785 CCTGCTTGGCAGAGAGAAAAGGG + Intergenic
1181871755 22:25904897-25904919 CCTGGTGGCCAGAAAGAAAAAGG + Intronic
1183837400 22:40466496-40466518 CCTCTTTGTCAGAAAGAAAAAGG + Intronic
1185159871 22:49217145-49217167 CTAGTTTACCAGACAGAACCAGG + Intergenic
949554926 3:5144615-5144637 CCAGTTTACCAGAAAGGAGAAGG - Intronic
950855742 3:16103128-16103150 CCTGTCTTCCAGACAGTACAAGG + Intergenic
950961886 3:17116276-17116298 TCTGTTTTTCAGAAAGAAAAGGG - Intergenic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
953811240 3:46114656-46114678 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
955648041 3:61161938-61161960 CCAGTTTACAAGAGAAAAAACGG + Intronic
955698328 3:61658493-61658515 CCTATTTTCAAGATAGAAAAAGG - Intronic
957122071 3:76106810-76106832 CCTATTCATCAGACAGAAAAGGG - Intronic
957797142 3:85024303-85024325 CCAGTTTTATAGACAGAAAAGGG + Intronic
957972170 3:87396561-87396583 TATGTTTATCAGACAGAAAGAGG + Intergenic
959964092 3:112333891-112333913 CCAGCTTACAAGACAAAAAACGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961243634 3:125433472-125433494 CCTTTTTACAAGTTAGAAAACGG + Intergenic
961432901 3:126895852-126895874 CCTGATTGCCACACAGAAGATGG + Intronic
963235703 3:142953651-142953673 CCTGTGGACCAGACAGCCAATGG + Intronic
963672496 3:148269639-148269661 ACTGTCTACGAGCCAGAAAATGG - Intergenic
965400407 3:168206412-168206434 ACTGTTCCCCAGACTGAAAAGGG + Intergenic
967295375 3:187959025-187959047 CCTGACTACTAGTCAGAAAAGGG + Intergenic
967342667 3:188417385-188417407 GTTGTTTACCAAGCAGAAAAGGG + Intronic
967387529 3:188926227-188926249 CCTCTTTGCCAGACAAATAAGGG - Intergenic
967480865 3:189971999-189972021 CCTGCTGACCTGCCAGAAAAGGG + Exonic
969686061 4:8674923-8674945 CCTGTTTTGCAGAGAGAAGAGGG - Intergenic
970519253 4:16865556-16865578 CACATTTACCAGACGGAAAATGG - Intronic
971927882 4:33037737-33037759 CCAGTTTACCACACAGGAACAGG - Intergenic
974662333 4:64908277-64908299 CCCTTTTAGCAGACAGAACAAGG + Intergenic
975991395 4:80263388-80263410 CCAGTTTTCCACACAGAAATAGG + Intergenic
976842502 4:89447620-89447642 CCTATTTATAAGAAAGAAAAAGG - Intergenic
981300274 4:143178935-143178957 TCAGTTTACCAGAGAGAAGAAGG - Intergenic
984129269 4:175852764-175852786 CCTGTTTCCCTGACAGCAGATGG - Intronic
984995516 4:185426457-185426479 TCTGTTTCCCAGAGAGGAAACGG - Intronic
986265546 5:6187124-6187146 CCAGTTTACTAGACAAAAAAAGG - Intergenic
988650420 5:33142794-33142816 CCAGTTTACCAGAAGGAACAAGG + Intergenic
991589206 5:68231427-68231449 CCTTTTAAACAGAAAGAAAAAGG + Intronic
992285646 5:75232820-75232842 CCTGTTTTCAAGAAGGAAAAGGG - Intronic
993396294 5:87393437-87393459 CCAGTTTCCCACACTGAAAATGG - Intronic
996452589 5:123642377-123642399 GCTGTTTATCTGAGAGAAAACGG + Intergenic
997988760 5:138526504-138526526 CAGGTTTTCCAGGCAGAAAATGG + Intronic
998571269 5:143260183-143260205 CTTTTTTACCACACAAAAAAAGG - Intergenic
998795854 5:145818054-145818076 CCTGTCCAACAGAAAGAAAATGG + Exonic
998883326 5:146667807-146667829 TCTGTTTACCAGTCTGAATATGG + Intronic
999894522 5:156015558-156015580 CCTGTTTACCAGACAGAAAAAGG + Intronic
1001296474 5:170502731-170502753 TCTGTGTGGCAGACAGAAAATGG + Intronic
1001839490 5:174862944-174862966 CCTGGTTAAAAGACACAAAATGG - Intergenic
1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG + Intergenic
1002202691 5:177539147-177539169 CCTGTCCAACAGACAGAAACAGG + Exonic
1003303008 6:4901967-4901989 TCAGCTGACCAGACAGAAAAGGG + Intronic
1003808213 6:9750534-9750556 ACTCTTTAGTAGACAGAAAAGGG + Intronic
1004588945 6:17030396-17030418 TCTGTTTACCAGAGAGCCAACGG - Intergenic
1008960640 6:57262216-57262238 CCACTTTACCAGCAAGAAAACGG - Intergenic
1010686829 6:78863179-78863201 ACTGTTAACCAGATAGCAAAGGG - Intergenic
1011846861 6:91575512-91575534 CATGTTTATCAGAGTGAAAATGG + Intergenic
1013399178 6:109774632-109774654 CCAACTTAACAGACAGAAAATGG + Intronic
1014701680 6:124696510-124696532 GCTGTCTACCGGACAAAAAATGG + Intronic
1014953876 6:127593035-127593057 CCAGGTTACCACACAGGAAAAGG + Intergenic
1015770566 6:136764055-136764077 CCTGTTTAAGCAACAGAAAATGG + Intronic
1016864356 6:148750467-148750489 CATTTTTTCCATACAGAAAATGG - Intronic
1018143911 6:160865298-160865320 CCTGGTTACCCGACATAGAAAGG + Intergenic
1019662101 7:2230310-2230332 CCAATTTACCAGACAAAAAATGG + Intronic
1021155649 7:17206536-17206558 ACTGTTTACAAAAGAGAAAATGG - Intergenic
1021231369 7:18088962-18088984 GCTTTTTCCCACACAGAAAATGG - Intronic
1021522428 7:21551195-21551217 CTAGTTTACCAGAGAGAAGAAGG - Intronic
1022334806 7:29412169-29412191 CTTGTTTACCAGGCAGACATGGG + Intronic
1022637397 7:32149938-32149960 CCCGTTTTCCAGACAGAATGTGG - Intronic
1024714018 7:52054006-52054028 CTTGTTTACCACAGAGAAGAGGG - Intergenic
1024737576 7:52322570-52322592 ACTGTATACTAGACAGAAAAGGG - Intergenic
1025105531 7:56168862-56168884 CATGTTAACCAGAGAGAAAGAGG - Intergenic
1026224916 7:68431829-68431851 CCTGTGTAGCAGGCAGTAAAGGG - Intergenic
1027412336 7:77934157-77934179 TCTGTATAGCAGACAGAAAAAGG - Intronic
1028256108 7:88599566-88599588 CCTGTTGACCAAAAAGAAACAGG + Intergenic
1031940346 7:127782252-127782274 GTTGTTTTCCAGGCAGAAAAGGG + Intronic
1032167106 7:129554070-129554092 CCTGTTTGATAGACAGGAAACGG - Intergenic
1032699436 7:134365919-134365941 CCTGCTTTCCAGATACAAAAGGG - Intergenic
1033036335 7:137879416-137879438 CCTGTTTTCATGACAGAGAAGGG - Exonic
1036531963 8:9598963-9598985 TCTGTTTATGAGACAGAAGAAGG - Intronic
1036687488 8:10921579-10921601 CCAGTATACCAAAGAGAAAACGG + Intronic
1039368430 8:36958875-36958897 ACTCTTTACCTGAAAGAAAAAGG - Intergenic
1039389203 8:37163448-37163470 GCTGCTTAGCCGACAGAAAAAGG - Intergenic
1039870258 8:41539991-41540013 CCTGTTTACCTGCCCGAAAGAGG - Exonic
1040606163 8:48933684-48933706 CCCATTTACCAGTCAGTAAATGG - Intergenic
1040744771 8:50628017-50628039 GCTGGTTACCAGAAAGAACAAGG - Intronic
1042648745 8:71015908-71015930 TCTGTTTACTATATAGAAAAGGG + Intergenic
1042793207 8:72631896-72631918 CTTGTAGACCATACAGAAAAAGG - Intronic
1043265475 8:78262249-78262271 CCTGTTTAGGAGAGAGGAAAAGG - Intergenic
1043740673 8:83807808-83807830 CCAGGTTACCACACAGAAACAGG + Intergenic
1045191851 8:99891467-99891489 CCTGTTTCAAAGAAAGAAAAAGG + Intronic
1047078520 8:121433118-121433140 CCTGTATACCATATAGATAATGG + Intergenic
1050077151 9:1877180-1877202 ATTGTTTCACAGACAGAAAAAGG - Intergenic
1053389760 9:37726164-37726186 GCTGTTTACGACACAGAGAAAGG + Intronic
1053684573 9:40509842-40509864 CATGTTTGCCAGTGAGAAAAGGG - Intergenic
1053934540 9:43138120-43138142 CATGTTTGCCAGTGAGAAAAGGG - Intergenic
1054201692 9:62089878-62089900 CCTGTTTAACTGAAAAAAAATGG + Intergenic
1054279152 9:63115119-63115141 CATGTTTGCCAGTGAGAAAAGGG + Intergenic
1054297669 9:63345304-63345326 CATGTTTGCCAGTGAGAAAAGGG - Intergenic
1054395684 9:64649815-64649837 CATGTTTGCCAGTGAGAAAAGGG - Intergenic
1054430328 9:65155010-65155032 CATGTTTGCCAGTGAGAAAAGGG - Intergenic
1054500052 9:65866511-65866533 CATGTTTGCCAGTGAGAAAAGGG + Intergenic
1054636667 9:67498481-67498503 CCTGTTTAACTGAAAAAAAATGG - Intergenic
1055117074 9:72616440-72616462 ACTGTTTACTAGACATGAAATGG + Exonic
1055348972 9:75365531-75365553 CCTGGCTACCAGAAAAAAAAAGG - Intergenic
1056447767 9:86682814-86682836 CTTGTTTGCCATACAGAAACAGG + Intergenic
1057578416 9:96263009-96263031 CCTGCTTACTAGTCACAAAAGGG - Intronic
1058759227 9:108113938-108113960 CCTGTTTTGCAGCTAGAAAAAGG - Intergenic
1059620333 9:115997768-115997790 CATGTTTAGCAGACACACAAAGG + Intergenic
1060260129 9:122067176-122067198 CCTGTTTTCCAAACAAAGAAGGG - Intronic
1060687668 9:125625896-125625918 CCTATTTTTCAGACAGAAGAAGG - Intronic
1061487738 9:130928840-130928862 CCATTTTCCAAGACAGAAAATGG - Intronic
1185828051 X:3271873-3271895 CCTGCTACCCAGAGAGAAAAGGG + Exonic
1185916497 X:4041301-4041323 CCAGATTAACAGACAGATAAAGG - Intergenic
1186108193 X:6227872-6227894 GCTGTTAACCAGAAAGAAAAAGG - Intronic
1187111937 X:16311214-16311236 CCTTGTTCCCAGACAGAACAAGG - Intergenic
1188236430 X:27737411-27737433 GTTGTATACCAGACAGAAAAGGG + Intronic
1188905448 X:35785874-35785896 CCTGATGACTAGAAAGAAAATGG - Intergenic
1190458470 X:50647203-50647225 CTTGTTTAACTGACAGAAGAGGG + Intronic
1192822810 X:74662209-74662231 CCAGTTTACCAGATAGAACCAGG - Intergenic
1193918286 X:87394789-87394811 CCTGTTTACTTGACGGATAATGG + Intergenic
1194341306 X:92709562-92709584 ATTGTTTGCCAGCCAGAAAATGG - Intergenic
1194788544 X:98117393-98117415 TCTGATTAACAGACAGAAATTGG + Intergenic
1195497074 X:105549063-105549085 CGTGTTTACCATACACAGAAAGG - Intronic
1196857379 X:119996851-119996873 CCTTTTTTTCAGACAGAATAGGG - Intergenic
1197026528 X:121756522-121756544 CCTGTTGACCACAGAGAGAAGGG + Intergenic
1197172759 X:123452893-123452915 CCTATTTTCAAGACAGAGAATGG - Intronic
1197427680 X:126318210-126318232 CCTTATCACCAGATAGAAAATGG - Intergenic
1197728244 X:129790727-129790749 CCTGGTTACCTCACAGAAACAGG - Intronic
1197858381 X:130943521-130943543 GCTGTCTACTAGACAGAAGAGGG + Intergenic
1199520825 X:148733459-148733481 ACAGTTTCTCAGACAGAAAAAGG - Intronic
1200649658 Y:5826275-5826297 ATTGTTTGCCAGCCAGAAAATGG - Intergenic
1201584555 Y:15546400-15546422 CATGTTTCCCAGCCAGAGAAAGG - Intergenic