ID: 999895602

View in Genome Browser
Species Human (GRCh38)
Location 5:156030242-156030264
Sequence GTCACATTCTTAGATCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999895602_999895605 -6 Left 999895602 5:156030242-156030264 CCTGTAGGATCTAAGAATGTGAC 0: 1
1: 0
2: 3
3: 50
4: 441
Right 999895605 5:156030259-156030281 TGTGACCTTATTTGGAAATAGGG 0: 355
1: 1110
2: 1637
3: 2195
4: 2988
999895602_999895607 20 Left 999895602 5:156030242-156030264 CCTGTAGGATCTAAGAATGTGAC 0: 1
1: 0
2: 3
3: 50
4: 441
Right 999895607 5:156030285-156030307 TTGCAGATGTAATCAAGTTAAGG 0: 9
1: 113
2: 396
3: 853
4: 1286
999895602_999895604 -7 Left 999895602 5:156030242-156030264 CCTGTAGGATCTAAGAATGTGAC 0: 1
1: 0
2: 3
3: 50
4: 441
Right 999895604 5:156030258-156030280 ATGTGACCTTATTTGGAAATAGG 0: 400
1: 1150
2: 1714
3: 2347
4: 3562
999895602_999895608 25 Left 999895602 5:156030242-156030264 CCTGTAGGATCTAAGAATGTGAC 0: 1
1: 0
2: 3
3: 50
4: 441
Right 999895608 5:156030290-156030312 GATGTAATCAAGTTAAGGCGAGG 0: 1
1: 6
2: 117
3: 313
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999895602 Original CRISPR GTCACATTCTTAGATCCTAC AGG (reversed) Intronic
900754377 1:4423509-4423531 GTCACATTCTCAGATACTAGCGG - Intergenic
900825919 1:4926896-4926918 GTCATATTCTGAGATCCTGGGGG - Intergenic
900919117 1:5659591-5659613 GCCACATTCTGAGGTCCTGCAGG + Intergenic
902110694 1:14075895-14075917 GTCACATTCCAAGGTCCTAGGGG - Intergenic
902112480 1:14094044-14094066 GTCACATTTTTAGGTATTACGGG + Intergenic
902686934 1:18083856-18083878 GTCACATTCCTAGATACTGGGGG + Intergenic
902759081 1:18569169-18569191 GTCACATTCTGAGATTCTGGGGG + Intergenic
903473619 1:23604730-23604752 GTCACATTCTGAGGTACTACGGG - Intronic
904271383 1:29352657-29352679 GTCACATTCTGAGGTACTAGAGG + Intergenic
905565057 1:38957503-38957525 GTCACATTCTGAGACACTAAGGG + Intergenic
908618271 1:65947516-65947538 GTCACATTCATAGATACCAGGGG - Intronic
908825808 1:68131722-68131744 GTCACATTCTGAGGTTCTAGGGG - Intronic
910554290 1:88513569-88513591 GTCACATTCTGAGATACTGAGGG + Intergenic
911248380 1:95546303-95546325 GTCACATTCTTAGATACTGGAGG - Intergenic
912405064 1:109430805-109430827 GTCACATTCTGAGATACTGGGGG - Intergenic
912693267 1:111820682-111820704 GTCACCTTCTTAGCTTCTAGGGG - Intronic
913041138 1:115025164-115025186 TTCACATTCTGATATACTACAGG + Intergenic
913285636 1:117224173-117224195 GTCACATTCTGAGGTACTAAAGG + Intergenic
913702041 1:121383224-121383246 TTCACCTTCTTTGATCCTGCTGG - Intronic
914042600 1:144063693-144063715 TTCACCTTCTTTGATCCTGCTGG - Intergenic
914135487 1:144896795-144896817 TTCACCTTCTTTGATCCTGCTGG + Intronic
916023196 1:160812343-160812365 GTCACATTCTGAGGTGCTAGAGG + Intronic
917040184 1:170797135-170797157 GCTACATTCTGAGATACTACTGG - Intergenic
917870257 1:179235273-179235295 GTCACATTCTGAGGTACTGCAGG - Intergenic
918512777 1:185329564-185329586 GTCCCATTCTGGGATCCTCCTGG + Intergenic
918745294 1:188190165-188190187 GTCACATTCTGAGGTCCTGGTGG + Intergenic
919251634 1:195064240-195064262 GTCACATTCTGAGGTACTAGGGG - Intergenic
920007238 1:202842333-202842355 GTCACATTCTGAGATACTGGGGG + Intergenic
920269659 1:204753247-204753269 GTCACAAAGTTTGATCCTACAGG + Intergenic
920489463 1:206401944-206401966 TTCACCTTCTTTGATCCTGCTGG - Intronic
920907108 1:210181524-210181546 GTCACATTCTAAGAACACACGGG + Intergenic
920911084 1:210217448-210217470 GTCACATTCTGAGACACTAGGGG - Intergenic
921585795 1:216944846-216944868 CTCACAGTATTAGAACCTACAGG + Intronic
922078303 1:222269447-222269469 GTCACATTCTGAGTTGTTACAGG + Intergenic
922293379 1:224227762-224227784 ATCACATTCTGAGGTCCTGCGGG - Intronic
922810106 1:228410577-228410599 GTCACATTCTGAGGTCCTGAGGG - Intronic
923057800 1:230440654-230440676 GTCAGATTCTGAGGTCTTACAGG + Intergenic
923103400 1:230835733-230835755 GTCACATTCTGAGATACTGGGGG - Intergenic
923552847 1:234977994-234978016 GTCACATTCTGAGGTCCTGGGGG + Intergenic
923746150 1:236702080-236702102 ATCACATTTTAAAATCCTACTGG - Intronic
924757073 1:246951244-246951266 GTCACATTCTGAGATACTGGGGG - Intronic
924796879 1:247299167-247299189 GTCACATTCTGAGGTACTAGAGG - Exonic
924797808 1:247305066-247305088 GTCACATTCTGAGGTCCTTAGGG - Intronic
1063016591 10:2084041-2084063 GTCACATTCTGAGATGCTAGAGG - Intergenic
1064005133 10:11693312-11693334 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1065249814 10:23799240-23799262 GTCACATTCTGAGGTCCTGGGGG + Intronic
1065812013 10:29450992-29451014 GTCACATTCTGAGGTACTAGGGG + Intergenic
1066064643 10:31753189-31753211 GTCACATCCTGAGGTCCTAGAGG - Intergenic
1067204432 10:44200960-44200982 GTCACATTCTGAGCTACTAGGGG - Intergenic
1067215544 10:44299822-44299844 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1067735526 10:48847337-48847359 GTCACATTCTGAGGTACTAGGGG + Intronic
1067788265 10:49268503-49268525 GTCACATTCTGAGATACTAGAGG + Intergenic
1068133112 10:52920144-52920166 GTCACATTTTGAGATACTAGGGG - Intergenic
1070872601 10:79770125-79770147 GTCACATTCTGAGATACTGGGGG + Intergenic
1071151893 10:82645642-82645664 TTCATATTCTTATATCCTAAAGG - Intronic
1071237017 10:83660976-83660998 GTCACATTCTGAGATACTTGGGG - Intergenic
1071639523 10:87292274-87292296 GTCACATTCTGAGATACTGGGGG + Intergenic
1071655712 10:87445678-87445700 GTCACATTCTGAGATACTGGGGG - Intergenic
1072468520 10:95690400-95690422 GTCACCGTCTTAGAACCTATAGG - Intronic
1072559604 10:96558731-96558753 GTTCCATTCTTAGACTCTACCGG - Intronic
1073620107 10:105037739-105037761 GTCACATTCTGAGATGCTAGAGG + Intronic
1073626684 10:105105412-105105434 GGCACATTCCTGGATCCTGCAGG - Exonic
1074583113 10:114740097-114740119 GACACACTCTTAGATACTTCTGG - Intergenic
1074858033 10:117487804-117487826 GCCACATGCTTAGGTACTACAGG + Intergenic
1075623030 10:123941544-123941566 GTCACATTCAGAGGTCCTAGAGG + Intergenic
1076290376 10:129341041-129341063 GTCACACTCTGAGGTCCTGCGGG + Intergenic
1077795359 11:5485863-5485885 GTCACATTCTGAGATGCTGAGGG - Intronic
1077926238 11:6684108-6684130 GTCACATTCTGAGTTACTGCAGG - Intergenic
1078910352 11:15725236-15725258 GTCACATTCTGAGGTCATAGAGG + Intergenic
1078942538 11:16023984-16024006 GTCACATTCTGAGGTACTAGGGG - Intronic
1079056893 11:17213937-17213959 GTCACATTCTGAGATATTAAGGG + Intronic
1080878625 11:36299004-36299026 GTCACATTCTAAGGTCCTGGGGG + Intronic
1082760202 11:57119979-57120001 CTCACATTCTTAGGTACTAAAGG - Intergenic
1084715543 11:70871183-70871205 GTCACACTCTGAGATCCTCAGGG + Intronic
1085752088 11:79170424-79170446 GTCACATTCTAAGGTACTAGGGG - Intronic
1087293538 11:96343714-96343736 ATCACATTGTTAGCTCCTAAAGG + Intergenic
1088605956 11:111532335-111532357 GTCACATTCTGAGGTACTGCTGG - Intronic
1089620986 11:119722017-119722039 GACACTTTCTAACATCCTACTGG + Intronic
1089790715 11:120941524-120941546 GTCACATTCACAGGTCCTAGAGG - Intronic
1090682429 11:129076152-129076174 GTCTCATTGTTAGATCATATAGG - Intronic
1091470630 12:723618-723640 GTCACATTCTGAGATACTGGGGG - Intergenic
1091854902 12:3731656-3731678 GTCACATTCTGAGGTACTAGGGG - Intronic
1092983244 12:13819021-13819043 GTCACATTCTTAGGTCCTAGTGG - Intronic
1093143945 12:15542024-15542046 GTCACATTCTGAGGTACTAAGGG + Intronic
1093184404 12:16003358-16003380 GTCACATTCTTACATGCTAGGGG + Intronic
1093227804 12:16506544-16506566 GTCACAATCTCACATCCCACAGG - Intronic
1093687539 12:22073812-22073834 GTGACATTCTTACTTACTACAGG + Intronic
1095417146 12:41989525-41989547 GTCACATTCACAGATTCTAGGGG - Intergenic
1095441682 12:42244320-42244342 GTCACATTCTAAGATACTGGGGG + Intronic
1095518743 12:43037076-43037098 GTCACATTCTGAGATTCTGGTGG - Intergenic
1096212913 12:49780108-49780130 GTCACATTCTGAGATACTGGGGG + Intergenic
1097445872 12:59670326-59670348 GTCACATTCTGAGATACTGGAGG + Intronic
1097708530 12:62893834-62893856 GTCACATTCTGAGGTACTAGGGG + Intronic
1097935610 12:65246720-65246742 GTCACCTGCATAGTTCCTACAGG + Exonic
1097945224 12:65360195-65360217 GTCACATTCTGAGATATTAGGGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099713934 12:86265461-86265483 GTCACATACTTATAGCCAACTGG - Intronic
1100171375 12:91978521-91978543 GTCACATTCTGAGATACTAGGGG + Intergenic
1100232665 12:92624801-92624823 GTCACATTCTGGGGTCCTAGGGG - Intergenic
1101163908 12:102008272-102008294 GTCAGATTCTCAGCTTCTACTGG - Intronic
1101343363 12:103862924-103862946 ATCACATTCTGAGATACTAGGGG - Intergenic
1101702924 12:107192145-107192167 GTCACATTCTGAGATTCTTGGGG + Intergenic
1102327293 12:111997915-111997937 GGCACAGTCATAGATTCTACTGG + Intronic
1103179842 12:118900864-118900886 GTTCCATGCTTAGATCCTAGCGG - Intergenic
1103553960 12:121754755-121754777 GTCACATTCTGAGGTCCCAGTGG + Intronic
1106437857 13:29739761-29739783 GTCACATTCTGAGGTCCTGGGGG - Intergenic
1107687654 13:42920163-42920185 GTCACATTCTGAGGTGCTAGGGG + Intronic
1107875435 13:44786864-44786886 GTCACATTCTGAGGTGCTAGGGG - Intergenic
1108064359 13:46562582-46562604 GTCACATTCTGAGGTGCTAGGGG + Intronic
1108701250 13:52946138-52946160 GTCAAATTCACAGATCCTAGGGG + Intergenic
1108718707 13:53107948-53107970 GTCACATTCTGAGGTACTGCGGG + Intergenic
1108926823 13:55759831-55759853 GTAACATTCTTAAATTTTACTGG - Intergenic
1109072820 13:57789990-57790012 GTCACATTCTTAGGTGCTGAGGG + Intergenic
1111079109 13:83278915-83278937 GTCACATTCTTTATTCATACAGG - Intergenic
1111462921 13:88569673-88569695 ATAACATTCCTAGATCTTACAGG + Intergenic
1112097620 13:96151989-96152011 GTTACATTCTGAGATACTAGGGG + Intronic
1112601374 13:100858830-100858852 GTCACATTCTGAGGTACTAGGGG - Intergenic
1112694927 13:101937304-101937326 GTCACATTCTGAGGTACTAGGGG - Intronic
1114744083 14:25128004-25128026 GTCACATTCTGAGATACTGGAGG - Intergenic
1114875032 14:26706394-26706416 GTCACATTCTGAGGTCCTGTGGG - Intergenic
1115620817 14:35138286-35138308 GTCACATTCTGAAATACTATGGG + Intronic
1115859904 14:37673101-37673123 ATCACATTTTTAGAGCCAACAGG + Intronic
1118167989 14:63356886-63356908 GTCACATTCATAGTTCCTGGTGG + Intergenic
1118461032 14:65987276-65987298 GTCACATTCTGAGGTACTACGGG + Intronic
1119105035 14:71915757-71915779 GTCACATTCTGAGGTACTAGGGG - Intergenic
1119129714 14:72160542-72160564 GTCACATTCTGAGATACTGGGGG - Intronic
1119925333 14:78488261-78488283 GTCACATTCTGAGGTCCTGAAGG + Intronic
1120014770 14:79459266-79459288 GTCACATTCTGAGATACTGAGGG - Intronic
1120157527 14:81110235-81110257 GTCACATACTAAGATGCTAGAGG - Intronic
1120528805 14:85608119-85608141 GTCACATTCTGAGATACTGGGGG + Intronic
1121364754 14:93299044-93299066 GGGACATTCATATATCCTACTGG + Intronic
1121542212 14:94736906-94736928 GTCACATTCTGAGATTCTGGGGG - Intergenic
1121683432 14:95813717-95813739 GTCACATTCTGAGATACTGAAGG + Intergenic
1122022498 14:98850799-98850821 GTCACATTTTGAGATACTAGGGG - Intergenic
1123107138 14:105846973-105846995 GGCACATTCTGAGGCCCTACGGG - Intergenic
1124015957 15:25875904-25875926 GTCACATTCTAAGATACTTGGGG + Intergenic
1124351533 15:28959343-28959365 GTCACATTCTGAGGTCCTGGGGG - Intronic
1125783163 15:42289776-42289798 GTCACATTCTGAGGTACTAGAGG - Intronic
1126010268 15:44295826-44295848 GTTACATTCTGAGATCCTGGAGG + Intronic
1126163974 15:45638266-45638288 GTCACATTCTAAGATCCTGGGGG - Intronic
1126289222 15:47053992-47054014 ATGAAATTCTTAGATCATACAGG - Intergenic
1128396366 15:67230320-67230342 GTCACATTCTAAGATACTGGAGG - Intronic
1130702393 15:86197830-86197852 GTCAGATTCTTGGATGCTTCAGG + Intronic
1131036549 15:89226201-89226223 GTCACATTCTGAGGTCCTGGGGG - Intergenic
1131778742 15:95831073-95831095 ACTAGATTCTTAGATCCTACTGG + Intergenic
1132208936 15:100006132-100006154 GTCACATTCTGAGATACTGGGGG + Intronic
1133418683 16:5626477-5626499 GTCACATTCTGAGCTCCTGGCGG + Intergenic
1133573372 16:7064053-7064075 GTCACATTCTGAGTTACTAGAGG - Intronic
1133922112 16:10162704-10162726 GTCACATTCAGAGATACTAGGGG + Intronic
1134350147 16:13429910-13429932 GTCACATTCTGAGATACTAAGGG - Intergenic
1135053222 16:19209190-19209212 GTCACATTCAGAGATCCTGGGGG + Intronic
1135084951 16:19467819-19467841 GTCACATTCTAAGGTACTAGGGG + Intronic
1135946505 16:26869592-26869614 GTCACATTCTGAGGTACTAGGGG + Intergenic
1136290578 16:29269042-29269064 GTCACATTCTTAGGCCCTGGGGG + Intergenic
1137016054 16:35376599-35376621 GTCACATTCTTAGGTGCTGGGGG - Intergenic
1137801625 16:51266909-51266931 GTCACATTCTGAGATACTGGGGG - Intergenic
1138145939 16:54611960-54611982 GTCACATTCTGAGGTACTAGGGG - Intergenic
1138343462 16:56305962-56305984 GTCACATTCTGAGGTCCTGGGGG + Intronic
1138721601 16:59088721-59088743 GTTACATTCTGAGATACTATGGG - Intergenic
1138891018 16:61144198-61144220 GTCACATTCTAAGATACCAGGGG + Intergenic
1139300137 16:65938024-65938046 GTCACATTCTGAGATATTGCAGG + Intergenic
1139706893 16:68747102-68747124 GTGGCATTCTTGGAGCCTACTGG - Intronic
1140786723 16:78349322-78349344 GTCACATTCTGAGGTAGTACGGG + Intronic
1141377257 16:83542905-83542927 GTCACATTCTGAGATATTAAGGG + Intronic
1141409442 16:83822450-83822472 GTCACATTCACAGATCCCAAGGG + Intergenic
1142096458 16:88242562-88242584 GTCACATTCTTAGGCCCTGGGGG + Intergenic
1142526588 17:546594-546616 ATCACCTTCTCAGATGCTACTGG - Intronic
1143225977 17:5303602-5303624 TTCAGATTCTTTGATCCCACTGG + Intronic
1143345723 17:6247450-6247472 GTCACATTCTGAGGTACTAGTGG + Intergenic
1143901146 17:10175844-10175866 GTCACATTCTGAGGTACTAGGGG + Intronic
1144027586 17:11292217-11292239 GTCACATTCTTAGGTTCTGGTGG + Intronic
1144154985 17:12491616-12491638 GTCACATTCTGAGATACTGGGGG - Intergenic
1145774784 17:27520311-27520333 GACACATTCCTAGATCCAAGTGG + Intronic
1148889791 17:50799460-50799482 GTCACATTCTGAGATACTAGGGG + Intergenic
1148963338 17:51411924-51411946 GTTACATTCTTTTTTCCTACAGG + Intergenic
1149294926 17:55253442-55253464 GTCACATTCATAGGTACTAGGGG - Intergenic
1150016384 17:61561551-61561573 GCCACATTCCCAGATCCTACTGG + Intergenic
1150126822 17:62641541-62641563 CTTACATACTTAGATCCTTCAGG - Intronic
1150459984 17:65342378-65342400 GTCACATTCTGAGATACTGGAGG + Intergenic
1150469174 17:65421815-65421837 GTCACATTCTGAGGTACTAGGGG - Intergenic
1151530434 17:74700843-74700865 ATCACATTCTGAGATACTAAAGG - Intronic
1151643654 17:75414825-75414847 GTCACATTCTTAGGTACTGGGGG - Intergenic
1152138882 17:78524903-78524925 GTCACATTCTTACAACCAAAGGG + Intronic
1154056578 18:11018341-11018363 GTCACATTCTGAGATCCTGGGGG + Intronic
1154129590 18:11725173-11725195 GTCACATTCTGAGAGGCTGCGGG - Intronic
1158218886 18:55129489-55129511 GTCACATTCATAGGTGCTAGGGG - Intergenic
1158322343 18:56277445-56277467 GTCACATTCTGAGATTCTAGGGG - Intergenic
1158541738 18:58362542-58362564 GTCACTTTTTTAGTTCCTATGGG + Intronic
1158650731 18:59282729-59282751 GTCACATTCTGAGGTGCTGCGGG - Intronic
1159097970 18:63926449-63926471 GTCACATTCACAGGTACTACGGG + Intronic
1159674265 18:71262044-71262066 GTCACATTCTGAGGTTCTAGGGG - Intergenic
1159921662 18:74232230-74232252 GTCACCTTCTGAGATACTAAGGG - Intergenic
1160219666 18:76965553-76965575 TTCAGATTCTTTGGTCCTACGGG + Intronic
1161629937 19:5348799-5348821 GTCACATTCTGAGGTCCTAGGGG + Intergenic
1163100021 19:15089881-15089903 GTCACATTCTGAGGTCCTTGGGG - Intergenic
1164128367 19:22339105-22339127 CTCACATTCACAGAACCTACTGG - Intergenic
1164411244 19:28007391-28007413 GTCACATTCTGAGGTCCTGAGGG - Intergenic
1164976258 19:32574876-32574898 GTCACATTCTAAGATACTGGGGG + Intergenic
1166794306 19:45417177-45417199 GTCACTCTCTAAGCTCCTACTGG + Intronic
1167105504 19:47428013-47428035 GTAATTTTCTCAGATCCTACAGG - Exonic
1168081456 19:54013256-54013278 GTCACATTCTTAGGTACTGGGGG + Intergenic
925744482 2:7032777-7032799 GTCACATTCTGAGATACTAGGGG + Intronic
925814337 2:7732915-7732937 ATCACATTGTTAGACCCTCCAGG + Intergenic
925869109 2:8253849-8253871 GTCACATTCTAAGCTCCTGGAGG + Intergenic
926870981 2:17416859-17416881 GTCACATTCTGAGCTACTACTGG + Intergenic
927066382 2:19475338-19475360 GTCACATTCTGAGGTACTAGGGG - Intergenic
927359829 2:22220173-22220195 GTCACATTCTGAGATTCAAGTGG - Intergenic
927626467 2:24725541-24725563 GTCACATTCTGAGATACCAGGGG + Intronic
927816496 2:26222042-26222064 GTCACATTCTGAGATACTGGAGG - Intronic
931163425 2:59719013-59719035 GTCACATTCTGAGGTACTAGGGG + Intergenic
931898640 2:66763223-66763245 GTCACATTCTGAGATACTGAGGG - Intergenic
931986846 2:67750506-67750528 GTCACATTCTGAGATACTGGGGG + Intergenic
933641497 2:84766501-84766523 GCCACATTACTACATCCTACAGG - Intronic
933942511 2:87256257-87256279 GTCACATTCTGAGGTACTAGGGG - Intergenic
935285492 2:101560581-101560603 GCCACATTCTGAGATCCTGGGGG - Intergenic
935293133 2:101626478-101626500 GTCACATTCTGAGGTACTAGGGG + Intergenic
935331703 2:101982060-101982082 GTCACATTCTGAGATACTGGGGG + Intergenic
935417829 2:102837505-102837527 GACACACACTAAGATCCTACAGG - Intronic
935529869 2:104219120-104219142 GTCACATTCTGAGATACTGGGGG + Intergenic
936337714 2:111605311-111605333 GTCACATTCTGAGGTACTAGGGG + Intergenic
937122118 2:119447949-119447971 GTCACATTCTGAGATACTGGGGG - Intronic
937462306 2:122100149-122100171 GTCACATTCTGAGGTTCTACAGG + Intergenic
937510433 2:122589105-122589127 GTCACATTCCGAGATCCTGGGGG - Intergenic
937888309 2:126915566-126915588 GTCACATTCTGAGGTCCTGTGGG + Intergenic
939567635 2:143803322-143803344 GTCACATTCTGAGGTACTAGGGG + Intergenic
939886266 2:147685219-147685241 GTCACATTCTGAGTTCCAGCTGG - Intergenic
940157621 2:150675955-150675977 GTCACATTCTGAGATACTGGGGG - Intergenic
942245883 2:174007813-174007835 GTCACATTCTGAGGTACTAGGGG + Intergenic
942877191 2:180814904-180814926 GTCACATTCACAGATTCTAGGGG - Intergenic
944832442 2:203546354-203546376 GTCACATTCTGAGGTACTAGGGG + Intergenic
945124192 2:206490000-206490022 GTTACATTCTTAGGTACTAGGGG - Intronic
945549709 2:211205616-211205638 GTCACATTCTGAGATACTAAGGG + Intergenic
945588236 2:211694140-211694162 GTCACATTCATAGATACCAGGGG + Intronic
946015473 2:216600711-216600733 GTCACATATTCAGATCCTTCAGG - Intergenic
946769712 2:223076368-223076390 GTCACATTCTGAGATACTGGAGG - Intronic
948076289 2:235167628-235167650 GTCACATTCTGAGGTCCTGGGGG - Intergenic
948361328 2:237422563-237422585 GTCACATTCTGAGGTACTAGAGG + Intronic
948431440 2:237921657-237921679 GTCACATTCTGAGGTACTGCTGG + Intergenic
1169520883 20:6371819-6371841 GTAACATTCTTAGGTACTAGAGG - Intergenic
1169894480 20:10488162-10488184 GTCACATTCTGAGGTCCTGAAGG - Intronic
1170388988 20:15851610-15851632 GTCACATTCTGAGATACTGGGGG + Intronic
1170451711 20:16490135-16490157 GTCACATTCTGAGGTACTAGGGG - Intronic
1170757687 20:19219076-19219098 TTCACATTCTCAAATGCTACAGG - Intronic
1173135392 20:40434459-40434481 GTCACATTCATAGGTTCTAGGGG - Intergenic
1175699131 20:61124461-61124483 GTCACATTCTGAGATGCTGGAGG + Intergenic
1176188030 20:63792172-63792194 GTCACATTCTGGGGTCCTAGGGG + Intronic
1176935863 21:14866251-14866273 GTCACATTCTGAGATACTGAAGG - Intergenic
1177473549 21:21589860-21589882 GTCAAATTCTGAGATACTAGTGG - Intergenic
1177605601 21:23374210-23374232 GTCACATTCTAATATACTAGAGG - Intergenic
1177660126 21:24072017-24072039 GTCACATTCACAGATTCTAGTGG + Intergenic
1177695992 21:24571825-24571847 GTCACATTCTGAGGTCCTAAGGG - Intergenic
1177877522 21:26651919-26651941 GTTACATTCTGAGGTCCTAGAGG - Intergenic
1178402187 21:32296266-32296288 GTCACATTCTGAGATACTGGGGG + Intronic
1178694822 21:34783657-34783679 GTCACATTCTGAGGTCCTGGGGG + Intergenic
1178902668 21:36609816-36609838 GTCACATTCCTATATCCCAGTGG - Intergenic
1179095679 21:38312513-38312535 GTCACATTCTGAGGTACTAGGGG + Intergenic
1179104888 21:38390413-38390435 GTCACATTCTTAGATACTGCGGG - Intronic
1179708988 21:43201145-43201167 GTCACATTCTGAGGTACTACAGG + Intergenic
1180036480 21:45252880-45252902 GTCACATTCTGAGGTTCTAGGGG - Intergenic
1180920219 22:19517821-19517843 GTCACATTCTAAGGTCCTGGGGG + Intronic
1182358223 22:29732134-29732156 GTCCCATACTCAGATCCTTCTGG + Intronic
1182510271 22:30814756-30814778 GTCACATTCTGAGATCCTGGGGG + Intronic
950968304 3:17161892-17161914 TTCACATTTGTAGAACCTACCGG - Intronic
952308059 3:32162677-32162699 GTCACATTCTGAGATACTAGGGG + Intronic
952514662 3:34091750-34091772 GTCTCATTCTTGGAACCTCCTGG - Intergenic
955063486 3:55514623-55514645 GTGACATTCTCACATCCTATAGG - Intronic
955168229 3:56536330-56536352 GTCACATTCTGAGATACTGGAGG + Intergenic
956142766 3:66162294-66162316 GTCACATTCTGAGGTCCTGGGGG + Intronic
956289004 3:67642124-67642146 GTCACATTCTGAGATACTGAAGG + Intronic
956541176 3:70341297-70341319 CTCACAGTCCTAGATGCTACTGG - Intergenic
956722983 3:72134544-72134566 GTCACATTCTGAGATACTGGAGG - Intergenic
959199592 3:103229053-103229075 GTCACATTCTAAGAAACTAAGGG + Intergenic
959731912 3:109613731-109613753 GTCACATTCTGAGGTACTAGGGG - Intergenic
960742810 3:120853449-120853471 GTCACATTCTGAGGTACTAGGGG - Intergenic
961046537 3:123712425-123712447 CTCAAATTCCTAGATGCTACGGG + Intronic
962092222 3:132256434-132256456 GTCACATTCTTAGGTACTGAAGG - Intronic
962179113 3:133187062-133187084 GTAACATTCTTTTATTCTACTGG + Intronic
964215287 3:154273587-154273609 GTCACAATATTAGAGCATACTGG - Exonic
964741940 3:159975425-159975447 GAGACAGTGTTAGATCCTACAGG - Intergenic
965290979 3:166879928-166879950 ATCACATTCTGAGGTACTACGGG + Intergenic
965806573 3:172548345-172548367 GTCACATTCTGAGATACTGGGGG - Intergenic
965988639 3:174788641-174788663 GTAACATTCTGAGATACTAGGGG + Intronic
965989306 3:174797243-174797265 GTCACATACTTAGAGCCTACTGG - Intronic
966303927 3:178509571-178509593 GTCATATTCTGAGATACTAGGGG - Intronic
966403206 3:179567421-179567443 GTCACATTCTGAGGTACTAGGGG + Intronic
966409661 3:179635133-179635155 GTCACATTCTAAGGTACTAGGGG - Intergenic
966543102 3:181114132-181114154 GCCACATTCTTAGATACTGAGGG + Intergenic
966733181 3:183167656-183167678 GTCACATTCTGAGATACTTGGGG + Intergenic
969182725 4:5454555-5454577 GTCACATTCTGAGGTCCTGGGGG + Intronic
969286326 4:6204603-6204625 GTCACATTCTGAGCTCCTGGGGG - Intergenic
969577217 4:8043457-8043479 GTCACATTCTGAGGTCCTGAGGG - Intronic
969856115 4:10001201-10001223 GTCACATTCTGAGGTACTAGGGG - Intronic
969943515 4:10759346-10759368 GTCATATTCTTGGGTCCTAGGGG - Intergenic
970151354 4:13093955-13093977 GTCACATTCTGAGGTCCTGGAGG - Intergenic
970229809 4:13898071-13898093 GCCAACTTCTTAGATCTTACTGG - Intergenic
970748941 4:19334320-19334342 CTCACATTCTGAGATACTAGCGG - Intergenic
971161889 4:24141783-24141805 GTCACATCTTTAGATCCTGAAGG - Intergenic
971669219 4:29533980-29534002 GTCACATTCTGAGGTACTGCTGG - Intergenic
971841129 4:31853696-31853718 GTCACATTCTGAAATACTAGGGG - Intergenic
972167696 4:36307520-36307542 GTCACATTCTGAGGTACTAGGGG + Intronic
972359741 4:38315884-38315906 GTCACATTCTGAGATGCTGGGGG - Intergenic
972598009 4:40547247-40547269 GTCACATTGTGAGATACTAGGGG - Intronic
972834771 4:42856680-42856702 CTCACATTATTAGCTACTACGGG - Intergenic
974667937 4:64989672-64989694 GTCACATTCTTAGGTACTGCAGG + Intergenic
975923503 4:79421384-79421406 GTCACATTCTGAGGTACTAAGGG + Intergenic
976205715 4:82621520-82621542 GTCACATTCTGAGGTACTAGAGG + Intergenic
976832509 4:89331166-89331188 GTCACATTTTGAGATCCTGGGGG + Intergenic
977372442 4:96156457-96156479 ATCACATTCTGAGGTTCTACTGG - Intergenic
978524534 4:109652213-109652235 GTCACATTCTGAGGTACTAGGGG + Intronic
978991909 4:115094621-115094643 GTCACATTCTGAGATACTGGGGG - Intronic
979374998 4:119936072-119936094 GTCAGATTCTCAAATCCTACTGG - Intergenic
980632756 4:135457539-135457561 GGTACATTCTCAGATACTACAGG + Intergenic
981569007 4:146131975-146131997 GTCACATTCTGAGATACTGGAGG - Intergenic
981686617 4:147461913-147461935 GTCACATTCTGAGGTCCTGGGGG - Intergenic
981859110 4:149333493-149333515 GTCATATTCTGAGGTCCTAAGGG + Intergenic
982019410 4:151188812-151188834 ATCACATTCTGAAGTCCTACTGG - Intronic
982363870 4:154553534-154553556 GTCACATTCTTAGATACTGGGGG + Intergenic
983089147 4:163483849-163483871 GTCACATTCTAAGATACTAGTGG + Intergenic
983237033 4:165191276-165191298 GTCAAATTCTTAACTCCTTCAGG + Intronic
983347843 4:166549334-166549356 CTCACATGTCTAGATCCTACAGG + Intergenic
983689275 4:170448449-170448471 GTCACATTCTGAGGTGCTAGGGG + Intergenic
984271259 4:177551204-177551226 GTCACATTCTGAGATACTGGGGG - Intergenic
984773252 4:183456712-183456734 CTCACATTCGTAGACCCTATGGG + Intergenic
985026837 4:185746886-185746908 GGCACATTCTGAGGTCCTAGGGG - Intronic
985698590 5:1357331-1357353 GTCACATTCTGAGGTCCTGGGGG + Intergenic
985829524 5:2217892-2217914 GTCACATTCTGAGGTGCTAGGGG + Intergenic
986406243 5:7427698-7427720 GTCACATTCTGAGGTTCTAGGGG + Intronic
986661594 5:10064837-10064859 GTCACATTCTGAGGTGCTAGGGG - Intergenic
987741762 5:21917482-21917504 GTTACATTCTTAGCTCCTCAGGG + Intronic
988075269 5:26344221-26344243 GTCACATTCTGAGATACTGGGGG + Intergenic
988260715 5:28883126-28883148 GTCACATTACTGGATCCCACTGG + Intergenic
988360676 5:30232752-30232774 GTCACAGTCTGAGATACTAGGGG - Intergenic
988707666 5:33741491-33741513 GTCACATTCTGAGGTCCTGGGGG + Intronic
988984769 5:36606742-36606764 GTCACATTCTGTGTTCCTGCTGG + Intronic
990076761 5:51855236-51855258 GTTACATTCTGAGATACTAAGGG - Intergenic
991492256 5:67194854-67194876 GTCACATTCTGAGGTCCTGTGGG - Intronic
991613225 5:68469560-68469582 CTCACATTCTTAGATACTTGGGG - Intergenic
992046227 5:72892773-72892795 GGCACATTCTGAGATCCTGCCGG - Intronic
993415766 5:87628116-87628138 GTTACATTCTTTTATCCTACAGG + Intergenic
994184422 5:96802712-96802734 GTCACATGCACAGATACTACAGG - Intronic
995459547 5:112388487-112388509 GTCACTTTCATAGCTCCCACAGG + Intronic
996263800 5:121509190-121509212 GTCACATTTTAAGATACTAGGGG + Intergenic
996341132 5:122440213-122440235 GTAACATTCTTGAAGCCTACAGG + Intronic
996422179 5:123274787-123274809 GTCACATTCTGAGGTTCTAGGGG - Intergenic
997848016 5:137305433-137305455 GTCACATTCATAGATGCCAGAGG + Intronic
998144060 5:139716176-139716198 GTCACATTCTGAGATACTGAAGG + Intergenic
999076659 5:148802737-148802759 GTCACATTCTGAGGTACTAGGGG + Intergenic
999081607 5:148849409-148849431 GTCACATTGTGAGATACTAGGGG + Intergenic
999895602 5:156030242-156030264 GTCACATTCTTAGATCCTACAGG - Intronic
1000017350 5:157289719-157289741 GTCACATTCTGAGGTCCTGTGGG + Intronic
1000682576 5:164204316-164204338 GTCACATTCTGAGATACTTGAGG - Intergenic
1001056210 5:168452314-168452336 GTCACATTCTGAGGTACTAGGGG - Intronic
1001665003 5:173425392-173425414 GTCACATTCTGAGGTCCTGGGGG + Intergenic
1001773699 5:174313427-174313449 GTCACATTCTGAGGTACTAGGGG + Intergenic
1002700207 5:181118772-181118794 GTCACATTTTGAGGTCCTAGTGG + Intergenic
1003136790 6:3440296-3440318 GTCACATTCTGAGGTCCTGGGGG - Intronic
1003311265 6:4971789-4971811 GTCACATTCTGAGACGCTAGAGG + Intergenic
1003598271 6:7494388-7494410 GTCACATTCTGAGATACTAGGGG - Intergenic
1004510360 6:16279487-16279509 GTCACATTCTGAGATGCTAGGGG + Intronic
1005810616 6:29512682-29512704 GTCACATTCTGAGATACTGGGGG - Intergenic
1007509370 6:42363583-42363605 GCCACATTCTGAGATCCTAGGGG - Intronic
1008107114 6:47451072-47451094 GTCACATTCTGAGATTCTAGGGG - Intergenic
1008289025 6:49689757-49689779 ATCACATTCTTAGATAGTATGGG + Intergenic
1008773923 6:55011405-55011427 GTCACATTCTGAGATACTAGGGG + Intergenic
1008961231 6:57268307-57268329 TTAATATTCTTATATCCTACAGG - Intergenic
1009322678 6:62311918-62311940 GTCACATTCTGAGGTACTAGTGG - Intergenic
1009410071 6:63356159-63356181 ATCACATTCTGAGATCCTGAAGG + Intergenic
1009422955 6:63483895-63483917 GTCACATTCTGAGGTACTAGGGG + Intergenic
1009467087 6:63985022-63985044 GTCACATTCTGAGGTACTAGGGG - Intronic
1010049426 6:71485269-71485291 GTTACATTCTGAGATGCTAGAGG + Intergenic
1010950437 6:82030649-82030671 GTCACATTCTGAGGTACTAGGGG + Intergenic
1011264356 6:85499458-85499480 GTCACATTCTTAGTTACTGGGGG + Intergenic
1011870883 6:91891049-91891071 GTAACATTACTAGATCCTATGGG + Intergenic
1012405596 6:98893548-98893570 GTCACATTCTTAGGTACTGGGGG + Intronic
1013721697 6:113038344-113038366 GTCACATTCTGAGATACTATGGG - Intergenic
1013989079 6:116232231-116232253 GTCACATTCTGATATACTAGGGG + Intronic
1014451874 6:121591473-121591495 GTCACATTCTGAGGTACTAGGGG + Intergenic
1014960984 6:127684408-127684430 GTCACATTCTGAGATATTAGGGG + Intergenic
1015635034 6:135266517-135266539 GTCACATTCTGAGGTTCTAAGGG + Intergenic
1016185995 6:141197837-141197859 GTCACATTCTGAGGTGCTAGAGG + Intergenic
1016188374 6:141226889-141226911 GCCACAATCTTAGATACTAGGGG + Intergenic
1016440460 6:144077972-144077994 GTCACATTTTTTCCTCCTACTGG - Intergenic
1016825928 6:148388467-148388489 GACACATTCAAAGATCTTACTGG + Intronic
1016921097 6:149294449-149294471 GTCACATTCTGAGATACTGAGGG + Intronic
1017056718 6:150443313-150443335 GTCACATTCTAAGATACTAGGGG - Intergenic
1017751945 6:157496433-157496455 GTCACATTCTGAGGTCCTGGGGG - Intronic
1018430542 6:163718263-163718285 GTCACATTCATGGGTGCTACGGG + Intergenic
1019425985 7:977064-977086 GTCACATCCTAAGGTCCTAGTGG + Intergenic
1019800004 7:3081346-3081368 GTCACATTCTGAGGTCCTGGGGG - Intergenic
1021310789 7:19093471-19093493 GTCACATTGTGAGGTACTACTGG - Intronic
1021645803 7:22788504-22788526 GTCACATTCTAAGGTACTAGGGG - Intergenic
1022214366 7:28243604-28243626 GTCACATTCTCAGATACTGAGGG - Intergenic
1023094055 7:36642090-36642112 GTCACATTCTGAGCTTCTGCAGG - Intronic
1023280637 7:38565634-38565656 GTCACATTCTGAGGTGCTAGGGG + Intronic
1025124424 7:56333541-56333563 GTCACATTCTAAGGTCCTGGAGG - Intergenic
1026108892 7:67442945-67442967 GTCATATTCTGAGATACTAAGGG - Intergenic
1026118126 7:67513534-67513556 GTCACATTCTAAGATACTAGAGG - Intergenic
1026897733 7:74019952-74019974 GTCACATTCTGAGGTCCTGGGGG - Intergenic
1028749897 7:94371659-94371681 GTCACATTCTGAGGTACTAGGGG - Intergenic
1028913943 7:96238037-96238059 GTCACATTCTGAGGTTCTAGGGG - Intronic
1029295451 7:99536783-99536805 GTCACATTCTGAGGTACTAGGGG - Intergenic
1029554923 7:101262318-101262340 GTCACATTCTAAGGTCCTGGAGG - Intergenic
1030045715 7:105493567-105493589 GTCACATTCTGAGGTCCTGGGGG - Intronic
1030951981 7:115802196-115802218 GTCACATTCTAAGGTACTACAGG - Intergenic
1031981903 7:128133271-128133293 GTCACATTCTTAGGTACTGAGGG + Intergenic
1032687562 7:134251137-134251159 GTCACATTCTGAGATCCTGGGGG - Intronic
1032746605 7:134792692-134792714 GTCACATTCTGAGGTCTTAGGGG + Intronic
1032896099 7:136252530-136252552 GTCACATTCTGAGGTACTAGAGG - Intergenic
1033123729 7:138688866-138688888 GTCACATTCTGAGGTACTAGAGG - Intronic
1034362305 7:150510951-150510973 GTCACATTCTCAAGTCCTAGGGG - Intergenic
1034396958 7:150833653-150833675 GTCACATTCTGAGGTACTAGGGG + Intronic
1034445024 7:151109645-151109667 GTCACATTCTGAGGTCCTGGGGG + Intronic
1034542248 7:151765688-151765710 GTCACATTCTGAGGTCCTGGGGG + Intronic
1034545754 7:151787722-151787744 GTCACATTCTGAGGTCCTGGGGG - Intronic
1034563061 7:151894062-151894084 GTCACATTCATAGGTCCTGGGGG - Intergenic
1035046691 7:155972571-155972593 GTTACATTCTCAGGTCCTAGGGG - Intergenic
1035647312 8:1234552-1234574 GTCACATTCTGAGGTCCTGCAGG + Intergenic
1035664297 8:1369443-1369465 GTCACATTCTGAGGTCCTGGGGG + Intergenic
1036684974 8:10903540-10903562 GCCACATTCTGAGGTCCTAGGGG - Intronic
1036811954 8:11873146-11873168 GTCACATTCTGAGGTACTAGGGG + Intergenic
1037215577 8:16447274-16447296 GTCACATTCTGAGATACTGAGGG - Intronic
1037393144 8:18415827-18415849 GTCACATTCTGAGGTAGTACAGG + Intergenic
1037533794 8:19806296-19806318 GTTACATTCTGAGATACTATGGG + Intergenic
1037535691 8:19821726-19821748 GTCACATTCTGAGGTTCTGCGGG + Intronic
1038869435 8:31478473-31478495 GTCACATTCTGAGATACTGGGGG + Intergenic
1039896634 8:41721093-41721115 GTCACATTCTGAGGTCCTGGGGG - Intronic
1040783880 8:51142316-51142338 GTCCCATTCTGAGGTCCTATTGG - Intergenic
1040869974 8:52090426-52090448 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1040870750 8:52098257-52098279 GTCACATTCTGAGATACTGTGGG - Intergenic
1041240296 8:55843478-55843500 GTCACATTCTGAGGTCCTGAGGG - Intergenic
1041324756 8:56652488-56652510 GTCACATTCACAGATGCTAGGGG - Intergenic
1042658188 8:71124849-71124871 TTACCATTCTTAGATCCCACTGG - Intergenic
1043356399 8:79417584-79417606 GTCACATTCTGAGGTACTAGGGG + Intergenic
1043547970 8:81336357-81336379 GTCACATTCTAAGATACTGAGGG + Intergenic
1043665721 8:82810310-82810332 GTCACATTCTGAGGTACTAAGGG - Intergenic
1044387087 8:91601895-91601917 GTCACATTCTGAGGTACTAAGGG + Intergenic
1044798032 8:95923956-95923978 GTCAGATTCATAGGTCCTAAAGG + Intergenic
1044827154 8:96209498-96209520 GTCACATTCTGAGATGCTGGGGG + Intergenic
1045799703 8:106088002-106088024 GTCACATTCTGAGGTTCTAGGGG + Intergenic
1045804291 8:106139057-106139079 GTCACATTCTGAGGTCCTAGGGG + Intergenic
1045850403 8:106689438-106689460 GTCACATTCTGAGATACTGGAGG + Intronic
1046213766 8:111115233-111115255 GTCACATTCTGAGATACTTGAGG + Intergenic
1046704915 8:117439109-117439131 GTCCCATTCTGAGATACTAGGGG - Intergenic
1046852734 8:118993790-118993812 GTCACATTCTGAGATACTGGGGG + Intergenic
1047612869 8:126538248-126538270 GTCACATTCTGAAATACTAGGGG - Intergenic
1048084990 8:131167664-131167686 GTCACATTCTGAGATACTAAGGG - Intergenic
1048195034 8:132325450-132325472 GTCACATTCTGAGGTCCTAGGGG - Intronic
1048267600 8:133001177-133001199 GTCACATCCTGAGGACCTACGGG + Intronic
1048627264 8:136198837-136198859 GTCACATTCTCAGGTACTAGGGG + Intergenic
1048714777 8:137256244-137256266 GTCACATTCTTAGATAGCAGAGG + Intergenic
1048892000 8:138956500-138956522 GTCACATTCTGAGGTCCTGGTGG - Intergenic
1050040626 9:1489289-1489311 TTCACATTCTTGGATGCTAGGGG + Intergenic
1051588196 9:18749153-18749175 GTCACATTCTGAGGTACTAAGGG + Intronic
1051778172 9:20658885-20658907 GTCACATTCTGAGGTACTAGGGG - Intronic
1053741086 9:41139141-41139163 TTCAGATTCTTTCATCCTACGGG + Intronic
1054731651 9:68706728-68706750 AACACATTCTGAGGTCCTACCGG - Intronic
1054879502 9:70130173-70130195 GTCACATACTGAGATACTAGAGG + Intronic
1055009988 9:71554520-71554542 GTAACATTCTCAGTTCCTAGAGG + Intergenic
1055344482 9:75320461-75320483 GTCACATTCATAGATGCTAGGGG + Intergenic
1056958716 9:91103133-91103155 GTCACATTCTGAGATACTGGGGG - Intergenic
1058503132 9:105642806-105642828 GTCACATTCTGAGATACTAGGGG - Intergenic
1058733285 9:107870473-107870495 GTCACATTGCTACATCCCACTGG + Intergenic
1058777880 9:108303050-108303072 GTCACATTCTGAGATCCTGGCGG - Intergenic
1059726621 9:117014649-117014671 GTCACATTCTGAGACACTAGAGG - Intronic
1059876520 9:118641379-118641401 GAAACATTCTTACAGCCTACTGG + Intergenic
1060050959 9:120377783-120377805 GTCACATTCTGAGGTACTAGGGG + Intergenic
1061410881 9:130420818-130420840 GTCACATTCTGAGGTCCTGGGGG + Intronic
1061700111 9:132409603-132409625 GTCACCCTCTTGGATCCTAAGGG - Intergenic
1185606227 X:1368545-1368567 GTCACATTCTGAGGTCCTGGGGG - Intronic
1185779624 X:2832939-2832961 GTCACATTCTGAGGTCCTGCAGG + Intronic
1185800721 X:3008006-3008028 GTCACATTCTGAGGTCCTGGGGG + Intronic
1185856531 X:3541424-3541446 GTCACATTCTGAGGTCCTGGAGG + Intergenic
1186009375 X:5111957-5111979 GTCACATTCTGAGGTCCTAGGGG + Intergenic
1186120856 X:6359534-6359556 GTCACATTCTAAAGTCCTAGGGG - Intergenic
1186186864 X:7029286-7029308 GTCACATTCTGAGGTCCTGGGGG + Intergenic
1186403067 X:9277400-9277422 GTCACATTCTAAGGTCCTGGGGG + Intergenic
1186943212 X:14535469-14535491 GAGACATTCTTAGAAACTACAGG + Intronic
1187186474 X:16991561-16991583 GTCACATTCTGAGGTACTAAGGG - Intronic
1188569033 X:31560021-31560043 GCCACCTGCTTAGCTCCTACAGG + Intronic
1189060922 X:37752978-37753000 GTCACATTCAGAGGTCCTAGGGG - Intronic
1189714717 X:43853554-43853576 GTCACATTCTGAGGTCCTAGGGG - Intronic
1189857711 X:45240001-45240023 GTCACATTCTCAGATACTGAGGG - Intergenic
1190009820 X:46774851-46774873 GTCACATTCTGAGGTACTAGGGG + Intergenic
1190413564 X:50160339-50160361 GTCACATTCTGAGATACTTGGGG + Intergenic
1190622943 X:52306274-52306296 GTCACATTCTGAGGTACTAGGGG + Intergenic
1190792191 X:53710861-53710883 GTCACATTCTGAGGTACTAGGGG - Intergenic
1193146938 X:78086283-78086305 GTCACATTCTGAGATACTGGGGG - Intronic
1193250451 X:79284753-79284775 CTCACATTCTTGTATGCTACTGG - Intergenic
1193999873 X:88414503-88414525 GTCATATTCTGAGATTCTAGGGG + Intergenic
1194871678 X:99140577-99140599 GTTATAATCTCAGATCCTACAGG + Intergenic
1197419238 X:126217537-126217559 GTCACATTCTGAGGTACTAGAGG - Intergenic
1197681153 X:129386754-129386776 GTCACATTCTGAGGTACTAAGGG - Intergenic
1199817652 X:151412945-151412967 GTCACATTCTCAGGTACTAGTGG + Intergenic
1201477195 Y:14395285-14395307 GTCACATTCTAAAGTCCTAGGGG + Intergenic
1201720633 Y:17093145-17093167 GTCACATTCTGAGGTGCTAGGGG + Intergenic