ID: 999897042

View in Genome Browser
Species Human (GRCh38)
Location 5:156045851-156045873
Sequence CTGTAGCCACAGTGGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999897033_999897042 -3 Left 999897033 5:156045831-156045853 CCTTAGAGGCCCCCCTCCAACTG 0: 1
1: 0
2: 2
3: 6
4: 144
Right 999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG 0: 1
1: 0
2: 3
3: 26
4: 262
999897031_999897042 19 Left 999897031 5:156045809-156045831 CCTCATTTAACTTGAATTACTTC 0: 1
1: 13
2: 160
3: 485
4: 1354
Right 999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG 0: 1
1: 0
2: 3
3: 26
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999897042 Original CRISPR CTGTAGCCACAGTGGGAGTT AGG Intronic
900171343 1:1270625-1270647 CTGGACCCACGGGGGGAGTTGGG - Intronic
900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG + Intergenic
902026089 1:13384723-13384745 CTGTAGACTCAGTAGGAATTTGG + Intergenic
902213584 1:14920991-14921013 CTGTGGCCACGGTGGCAGTTAGG - Intronic
902383467 1:16063538-16063560 CTGGAGCCACGGTGGGAGTGCGG + Exonic
903041031 1:20530799-20530821 CTGCTTTCACAGTGGGAGTTGGG + Intergenic
903745945 1:25586710-25586732 CTGTGCCCAGAGTGGGAGTGAGG - Intergenic
904207476 1:28864381-28864403 CGGTGGCCACAGTGGGGCTTGGG + Intergenic
904592941 1:31625394-31625416 CTGCACCCAGGGTGGGAGTTGGG - Intronic
904855580 1:33495806-33495828 GTGAAGGCACAGTGAGAGTTTGG - Exonic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
906382418 1:45341205-45341227 CTGTGGACACGGTGAGAGTTGGG + Exonic
906542707 1:46600150-46600172 ATGTAAACAAAGTGGGAGTTTGG - Intronic
908107258 1:60857726-60857748 CTGTCTCCTCAGTGAGAGTTGGG + Intergenic
908964431 1:69740833-69740855 ATACAGTCACAGTGGGAGTTAGG + Intronic
910229802 1:84974296-84974318 CTTTAGCCACCCTGGTAGTTTGG - Intronic
911205186 1:95085529-95085551 CCTTAGCCACAGCTGGAGTTTGG - Intergenic
915940579 1:160116012-160116034 CTGTACACACATTGGTAGTTTGG - Intronic
919469076 1:197956684-197956706 ATACAGCCACACTGGGAGTTAGG - Intergenic
920090067 1:203446358-203446380 ATACAGCCACATTGGGAGTTAGG - Intergenic
920437861 1:205959823-205959845 GTGTAGCCACGGTGGGAGGTAGG - Intergenic
921885135 1:220297767-220297789 CTGTAGTCACTGTGGGTGTAGGG + Intergenic
922786028 1:228282714-228282736 CTGTCACCACGGTGGGACTTGGG - Intronic
923495264 1:234519227-234519249 CTGCAGCCACCGCGGGAGTGAGG + Intergenic
1063056443 10:2509838-2509860 ATACAGCCACATTGGGAGTTAGG + Intergenic
1064847185 10:19668265-19668287 CTGTGGTGACAGTGGGAGTTTGG - Intronic
1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG + Intronic
1068533008 10:58210100-58210122 CTGCAGCCACTGTGGGGGATGGG + Intronic
1068828122 10:61462564-61462586 CTTTAGCCACAGTGAAAGCTGGG - Intergenic
1070648764 10:78220084-78220106 CTGTGGACACAATGGGAGTCTGG + Intergenic
1072381756 10:94879596-94879618 CTGTGGCTGCTGTGGGAGTTGGG + Intergenic
1072508472 10:96093751-96093773 ATATAGCCACAGCGGGGGTTAGG + Intergenic
1072552940 10:96493182-96493204 CTGTAGGCACAGAGAGATTTAGG + Intronic
1076267669 10:129121497-129121519 CTGGAACCACAGTGGGGCTTGGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1078539040 11:12198781-12198803 GTGCCACCACAGTGGGAGTTTGG - Intronic
1081386177 11:42476231-42476253 CTCTACCCACAGTGGGAGGAGGG - Intergenic
1084106903 11:66986227-66986249 TGGCAGCCACAGTGGGAGTAGGG - Intergenic
1084771984 11:71349307-71349329 CAGCAGACACTGTGGGAGTTGGG + Intergenic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1086304270 11:85462821-85462843 ATGTAGCCACAGTGTAAGTTAGG - Intronic
1086315696 11:85589536-85589558 CTGCAGCCACTGTGGGGGTGTGG + Intronic
1086869359 11:92018310-92018332 CTGTAGCCACTATGGGGGATGGG + Intergenic
1087700906 11:101435279-101435301 AGGTGGCCACAGTGGGAGTGGGG + Intergenic
1088693041 11:112344052-112344074 CTGGAGGCACAGTGGGGGTGGGG + Intergenic
1089530700 11:119126981-119127003 CTGTGGCTACAGTGTGAGTGGGG + Exonic
1089924691 11:122245295-122245317 ATGTAACCACAGTGTGAGATTGG + Intergenic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1091497330 12:983873-983895 ATATAGTCACACTGGGAGTTAGG + Intronic
1093602152 12:21040671-21040693 CTGTTGTCAGAGGGGGAGTTTGG + Intronic
1095131959 12:38553377-38553399 TTGTATTTACAGTGGGAGTTTGG + Intergenic
1095225797 12:39675239-39675261 CTGCAGCCACTGTGGGGGATGGG - Intronic
1095371001 12:41467183-41467205 CAGTAGACACAGTGAGAGTTTGG + Intronic
1095485500 12:42680216-42680238 CTGTAGCCAGAGTGGTAAATGGG + Intergenic
1096237833 12:49942098-49942120 CTGTCCCCACAGTGGGAGCAAGG - Intergenic
1096788146 12:54029488-54029510 CTGTACCCCCAGTGGGGGTGGGG + Intronic
1098279882 12:68851781-68851803 CTGTAGCTAAAGTAGAAGTTTGG - Exonic
1101861362 12:108485065-108485087 ATGTAGTCACATTGGGCGTTAGG - Intergenic
1102932119 12:116870398-116870420 CTCTAGCCAGTGTGGGAGTGTGG - Intronic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1104747642 12:131220029-131220051 CTGTAGGCACAGGGGGTGTTTGG + Intergenic
1105358057 13:19678231-19678253 TTGCAGACACAGTGGGAGTGAGG - Intronic
1106811665 13:33364343-33364365 CTCAAACCAGAGTGGGAGTTTGG + Intergenic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1110158055 13:72342351-72342373 CTGCAGCCACTGTGGGGTTTGGG + Intergenic
1112785768 13:102950551-102950573 GTGTGGCCCCAGTGGGACTTGGG - Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1115795419 14:36930116-36930138 CTGTAGCCACAGTTCCATTTAGG + Intronic
1116674386 14:47886973-47886995 ATATAGCCACAGTGGTGGTTAGG + Intergenic
1116941120 14:50791923-50791945 CTGTAGCCCCAGTCTGAGCTGGG + Intronic
1117122215 14:52580397-52580419 CTGTAGCCCAAGCTGGAGTTCGG + Intronic
1118062826 14:62159653-62159675 CTGAATCTACAGTGGGAGTCTGG + Intergenic
1119425830 14:74534156-74534178 CTGTGGCCACAGTGGGATGTGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120161384 14:81149048-81149070 ATATAGTCACATTGGGAGTTAGG - Intergenic
1122428851 14:101627454-101627476 CTGTAGTCCCAGTGGGAGTTTGG - Intergenic
1124268866 15:28262523-28262545 GTGGAGCCACATTGGGAGGTGGG - Intronic
1125624811 15:41099337-41099359 CTATCGCCACAATGGGAGTTTGG - Intronic
1126078362 15:44934779-44934801 CTACAGTCACATTGGGAGTTAGG + Intergenic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1129580127 15:76799982-76800004 CTGTTGCCACTGGAGGAGTTTGG - Intronic
1129942104 15:79507183-79507205 ATATAGCCACATTGGGGGTTAGG + Intergenic
1130214797 15:81958107-81958129 CTGTAGCCAAAGTTGGATTCAGG - Intergenic
1131980824 15:97992965-97992987 ATGTAACCAGAGTGGGAGATAGG + Intergenic
1132194086 15:99897169-99897191 CTGTGGCCAGGGTGGGAGTGGGG - Intergenic
1132240110 15:100251386-100251408 CTATAGTCACATTGGGAGTTAGG - Intronic
1133612964 16:7450515-7450537 CTGTAACCTAAGTGGGAGTCGGG - Intronic
1133919657 16:10140856-10140878 GTCTTGCCACACTGGGAGTTGGG + Intronic
1136086717 16:27890501-27890523 CTGTGGCCACAGTGGGAATGAGG + Intronic
1137637027 16:49995813-49995835 CTGTAACAACAGTGTGGGTTGGG - Intergenic
1138230628 16:55333146-55333168 CTTTAGCCATAGAAGGAGTTTGG - Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139303541 16:65964539-65964561 ATGTCGCCAGAGTGGGAGTGAGG - Intergenic
1139518130 16:67463932-67463954 CTGAAGCCACTGGGGGAGGTGGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1144444470 17:15314422-15314444 GTGTAGACAAGGTGGGAGTTAGG - Intronic
1144668639 17:17118859-17118881 CTGCAGCCCCAGAGGGACTTTGG + Intronic
1144795653 17:17889419-17889441 CTATAGGCACAGGGGGACTTTGG + Intronic
1145736035 17:27232277-27232299 CTGTAGCCACAGCGTGACCTTGG - Intergenic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147156667 17:38547633-38547655 CTGTGGCCATGGTGGGACTTGGG + Intronic
1147462154 17:40580004-40580026 CTGCAGCCATATTGGGGGTTAGG + Intergenic
1148321399 17:46757078-46757100 TTGTGGCCACAGTGGCACTTGGG + Exonic
1148704064 17:49612499-49612521 CTGAAGCCATAGTGGGAAGTTGG - Intronic
1150601006 17:66651017-66651039 CTGTACCTGCAGTGGGAGTTTGG + Intronic
1150647680 17:66989798-66989820 CAGTACCCACATTGGGAGGTTGG - Intronic
1151138329 17:71968763-71968785 ATGTAGTCACACTGGGTGTTAGG - Intergenic
1151496372 17:74460590-74460612 CTCCAGCCACTTTGGGAGTTAGG + Intergenic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1153285047 18:3449558-3449580 CAGCAGCGACAGTGGGAGGTCGG - Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1155252237 18:23963681-23963703 CTTGAGCCACGGTGGGTGTTGGG + Intergenic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1156326660 18:36079712-36079734 CTGCAGCCACTGTGGGAGATGGG - Intergenic
1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG + Intronic
1158687851 18:59630807-59630829 TTGTACCCACAGTGGGATTCAGG + Intronic
1165856396 19:38881233-38881255 CGGAGGCCACAGTGGGAGTTGGG + Intronic
1166556239 19:43701702-43701724 CTGTAATCACAGTGTGATTTTGG + Intergenic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1168137042 19:54359119-54359141 CTGAAGCCACATGGGGAGGTGGG - Intronic
1168161039 19:54510010-54510032 CTGAAGCCACATGGGGAGGTGGG + Intronic
926109711 2:10174008-10174030 ATGCAGCCACACTGGGGGTTTGG - Intronic
926219462 2:10925349-10925371 CTGGAGCCAGGGTGGGATTTGGG + Intergenic
927813922 2:26197369-26197391 CTGTAGCCAAACTGGTATTTTGG + Intronic
928756636 2:34534191-34534213 GTGGAGGCACAGTAGGAGTTGGG - Intergenic
931128014 2:59299036-59299058 ATGCAGTCACAGTGGGGGTTAGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
932320539 2:70819330-70819352 GAGTAGCCACAGTGGGGGTGGGG - Intronic
932416911 2:71579092-71579114 CTGTGGCCACAGGGGGTGTGGGG - Intronic
933131814 2:78681742-78681764 CAGCAGCCATAGTGGGTGTTGGG - Intergenic
935095614 2:99941580-99941602 GTGTAGTCACAGTGGAAATTAGG - Intronic
935989412 2:108705747-108705769 CTGTACCCACTGTGGGCCTTGGG + Intergenic
936505478 2:113102386-113102408 ATACAGCCACACTGGGAGTTAGG + Intergenic
936913478 2:117615995-117616017 CTGAAGCCAGGGTGGGCGTTGGG - Intergenic
937415337 2:121710219-121710241 CTGATGCCACTGTGGGGGTTAGG - Intergenic
937525137 2:122759273-122759295 ATACAGCCACACTGGGAGTTAGG + Intergenic
938648756 2:133358316-133358338 CCGTAATCTCAGTGGGAGTTTGG + Intronic
940067821 2:149649443-149649465 ATGTTGCCAGAGTGGGAGATGGG + Intergenic
940672474 2:156687698-156687720 CTATAGTCACACTGAGAGTTAGG + Intergenic
941200295 2:162499918-162499940 CCTTAGCTACATTGGGAGTTTGG - Intronic
943296183 2:186142794-186142816 ATATAGCCACATTGGGGGTTAGG - Intergenic
944839941 2:203615248-203615270 CAGTAGCTAGAGTGGGATTTAGG + Intergenic
947238675 2:227970835-227970857 CTGCATCCACCCTGGGAGTTGGG + Intergenic
947501547 2:230674800-230674822 CTTCAGCCCCAGTGGGAGCTGGG + Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171267149 20:23781088-23781110 TTTTAACCACAGTGGGTGTTAGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172839772 20:37895579-37895601 GTACAGCCACATTGGGAGTTAGG - Intergenic
1172899714 20:38325609-38325631 ATGCAGCCACACTGGGAATTAGG + Intronic
1175874258 20:62221973-62221995 CTGCAGCCTCAGTGGGTATTTGG - Intergenic
1178940056 21:36898011-36898033 CTGTAGCCACAGGGAGCTTTGGG - Intronic
1179133549 21:38660473-38660495 CTGTAGCCAGCGTGGGAGCCGGG + Intronic
1179180939 21:39044496-39044518 ATATAGCCACAGTGGTTGTTGGG + Intergenic
1179386691 21:40950163-40950185 TTTTAGCCAAAGTGGGAGTTAGG + Intergenic
1179900780 21:44392668-44392690 CTATAGTCACACTGGGGGTTAGG + Intronic
1180782985 22:18531342-18531364 CTCTGGCCACAGTGGAAATTAGG - Intergenic
1180829206 22:18890479-18890501 GTGTAGTCCCAGTGTGAGTTGGG - Intergenic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181239883 22:21470704-21470726 CTCTGGCCACAGTGGAAATTAGG - Intergenic
1181305951 22:21917380-21917402 CTGCAGGCAAAGTGGGAGTGGGG + Intergenic
1182547229 22:31083319-31083341 CTGTCCCCACAGTGGGTGATGGG - Intronic
1182760912 22:32721651-32721673 CTGTACCACCAGTGGGAGCTGGG - Intronic
1183728068 22:39600436-39600458 TTGCAGCCACAGTGTGAGGTGGG - Intronic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1203279298 22_KI270734v1_random:116517-116539 GTGTAGTCCCAGTGTGAGTTGGG - Intergenic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
952435553 3:33269498-33269520 TTGCAGCCACTGTGGGAGATGGG + Intergenic
954894429 3:53963711-53963733 CTGAGGCCACAGTGGGGTTTGGG + Intergenic
955552462 3:60099082-60099104 TTTTAGGCACAGTGGGAGATGGG - Intronic
958421430 3:93936131-93936153 ATATAGCCACACTGGGTGTTAGG - Intronic
959727535 3:109560990-109561012 CTGCAGCCACTGTGGGGGATGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960816598 3:121679800-121679822 CTGATACCACAGTGGGAGTGGGG - Intronic
961645790 3:128392180-128392202 CGGGACCCAGAGTGGGAGTTAGG + Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962023678 3:131526307-131526329 CTGCTGCCACAGTGGTAGTTAGG - Intergenic
962387110 3:134940515-134940537 CTGTAGCCACACTGGCATCTTGG + Intronic
963448772 3:145449664-145449686 ATATAGCCACATTGGGAGTTAGG + Intergenic
964219448 3:154327027-154327049 CTACAGCCATATTGGGAGTTAGG - Intergenic
965087142 3:164113746-164113768 CTGTAGCCTCAGTTTCAGTTTGG - Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
968272991 3:197419017-197419039 CTGGAGCCACAATGGGACTAGGG - Intergenic
968441464 4:626581-626603 CTTCTGCCACAGTGGAAGTTTGG - Intronic
969241174 4:5898965-5898987 CTGAAGCCAGAGTAGGATTTAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970856147 4:20651261-20651283 CTGCAGCCGCTGTGGGGGTTTGG - Intergenic
971472305 4:27040309-27040331 CTGTGGCCACTATGGGAGATGGG + Intergenic
972996989 4:44892790-44892812 ATATAGCCACACTAGGAGTTAGG - Intergenic
973343053 4:49026020-49026042 CTGTAGCTGCTGTGGGAGATGGG + Intronic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
975173343 4:71258800-71258822 CTATCGCCAAAGTGGGATTTTGG + Intronic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
979434605 4:120673703-120673725 CTGCAGCCACTGTGGGGGATGGG - Intergenic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
982768031 4:159369791-159369813 ATGCAGTCACATTGGGAGTTAGG + Intergenic
985355753 4:189116976-189116998 CTGTGGCTGCTGTGGGAGTTGGG - Intergenic
985606950 5:862928-862950 CTGGAGCCCCAGTGGAAGCTGGG + Intronic
986434889 5:7719787-7719809 ATACAGCCACACTGGGAGTTAGG + Intronic
986485115 5:8228404-8228426 CTTTGGGCACAGTGGGAGTTAGG - Intergenic
989372031 5:40720888-40720910 TTGTAGCCACCGTAGAAGTTGGG - Intronic
990236040 5:53768546-53768568 ATATAGTCACATTGGGAGTTAGG + Intergenic
990558231 5:56957656-56957678 ATATAGCCACACTGGGGGTTAGG - Intronic
990655813 5:57953959-57953981 CTACAGCCACACTGGGAGCTGGG - Intergenic
991554509 5:67880537-67880559 CTGTAGCCACTCTGGGAATAGGG - Intergenic
992486512 5:77202109-77202131 ATATAGCCACACTGGGGGTTAGG + Intergenic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996758810 5:126966171-126966193 CTGGAGGCAAAGTGGGTGTTGGG + Intronic
997675170 5:135707382-135707404 TTGCAGACTCAGTGGGAGTTTGG - Intergenic
998404673 5:141867646-141867668 CTCAAGCCAAAGTGGGAGATGGG - Intronic
998918648 5:147043275-147043297 ATGCAGCCACATTGGGGGTTGGG - Intronic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG + Intergenic
1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG + Intergenic
1001873295 5:175177047-175177069 GTGTAGCCACAATGACAGTTTGG - Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003499922 6:6695544-6695566 CTGGGGCGACAGTGGGAGTGTGG + Intergenic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1006454851 6:34125788-34125810 CTCTCACCACAGTGGGGGTTTGG + Intronic
1007761563 6:44136337-44136359 CTGAAGCCACACTGGGGGTGAGG - Exonic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1011295710 6:85825107-85825129 CTGTGGCTTCAGTGGGAGTTGGG - Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1012012074 6:93801453-93801475 ATGCAGCCACACTGGGAGTTGGG + Intergenic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013692388 6:112660877-112660899 CTGTTGCTAGATTGGGAGTTAGG + Intergenic
1014750074 6:125245583-125245605 CTGCAGCCACTGTGGGGGTTGGG + Intronic
1015328155 6:131948855-131948877 CTGTAGCCCCAGTGACAGCTAGG - Exonic
1016601593 6:145867712-145867734 CTATAACCACAGAGGTAGTTTGG + Intronic
1016911032 6:149199512-149199534 ATATAGTCACACTGGGAGTTAGG - Intergenic
1018177449 6:161189454-161189476 CTGTAGCCACACAGTGAGTGAGG + Intronic
1019386551 7:760001-760023 CTGTGGCTTCTGTGGGAGTTGGG + Intronic
1020768272 7:12353379-12353401 ATATAGCCACACTGGGAGTTAGG + Intronic
1021152271 7:17166079-17166101 ATATAGTCACACTGGGAGTTAGG + Intergenic
1022644380 7:32216912-32216934 CTCTAGCCCCAGTGGGAGGAGGG + Intronic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1026082437 7:67233942-67233964 ATATAGCCACGCTGGGAGTTAGG - Intronic
1026694632 7:72580051-72580073 ATATAGCCACACTGGGAATTAGG + Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1027720535 7:81735998-81736020 ATATAGTCACAATGGGAGTTGGG + Intronic
1029485544 7:100837580-100837602 CTGCAGCCACAGTGAATGTTTGG + Intronic
1033593569 7:142836460-142836482 ATATAGACACAGTGGGAGTGGGG + Intergenic
1035136538 7:156708985-156709007 CTGCAGCCACCGTGGTTGTTGGG - Intronic
1038046128 8:23766972-23766994 CTGCAGCCACACTGGGCATTTGG + Intergenic
1038867724 8:31457998-31458020 ATGTAGCCACACTAGGGGTTAGG - Intergenic
1039632109 8:39123412-39123434 CTGTCTCCACACTGGGGGTTTGG + Intronic
1039811137 8:41049277-41049299 CTGCAGTCACTGTGGGAGATGGG - Intergenic
1039849235 8:41348042-41348064 ATGCAGCCACGGTGGGAGTGTGG + Intergenic
1040541600 8:48362065-48362087 ATGCAGCCACACTGGGGGTTAGG + Intergenic
1040851944 8:51909951-51909973 ATATAGCCACAGTGGGAATTAGG + Intergenic
1041763710 8:61394503-61394525 CTGCAGCCACTGTGGGGGATTGG + Intronic
1042621776 8:70714225-70714247 ATATAGTCACATTGGGAGTTAGG + Intronic
1047853835 8:128888397-128888419 CTGTAACTACAGTAGGAATTAGG + Intergenic
1048668887 8:136694821-136694843 CTGAAGCCCCAGTGGGCGTGTGG + Intergenic
1049789145 8:144465183-144465205 CTGGAGCCCAAGTGGGAGTGCGG + Intronic
1050164937 9:2755601-2755623 ATATAGCCACAATGGGGGTTGGG + Intronic
1051530466 9:18096484-18096506 CTGTGGCCAGAGTAGGAGATGGG + Intergenic
1052165960 9:25328015-25328037 CTGTAGTCATATTGGAAGTTAGG + Intergenic
1054086377 9:60748937-60748959 ATGTAGCCAAATTGGCAGTTAGG + Intergenic
1055042283 9:71887567-71887589 TTGTAGCCACAGTGGCTGGTGGG - Intronic
1057202472 9:93149652-93149674 CTGTAGCAATTGTGGAAGTTTGG - Intergenic
1057974503 9:99590444-99590466 TTGTAGCCACTCTGGGACTTGGG + Intergenic
1058275657 9:103038199-103038221 CTGCAGCCCCTGTGGGTGTTGGG - Intergenic
1061658861 9:132114497-132114519 CTGTAGCCATGGTGGCATTTTGG - Intergenic
1061895109 9:133643108-133643130 CTGCAGCCCCAGTGGGAGGCAGG - Intronic
1062318812 9:135980621-135980643 CTGCAGCCACTGTGGGAGTGAGG - Intergenic
1062388014 9:136322368-136322390 CAGCAGCCTCAGTGGGAGTGGGG + Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1188058972 X:25577057-25577079 CTGGAGCCAGGGTGGGGGTTAGG - Intergenic
1188524559 X:31075125-31075147 CTGTAGCCACAGTGGGGCTGAGG + Intergenic
1188639556 X:32483240-32483262 GTGTAGCTACAGTGGAAGTGGGG + Intronic
1188956079 X:36436204-36436226 CAGTAGCCCTTGTGGGAGTTGGG - Intergenic
1189343347 X:40221313-40221335 ATATAACCACACTGGGAGTTAGG + Intergenic
1191708754 X:64124166-64124188 CTGTAGACACTTTGGTAGTTTGG - Intergenic
1192597473 X:72426789-72426811 GTATAGTCACAGTGGGGGTTAGG - Intronic
1193789462 X:85800680-85800702 CTGTATCCACAATGGTAGATGGG + Intergenic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1195769841 X:108339001-108339023 GTGTGGCCACAGGGGAAGTTGGG - Intronic
1196187682 X:112762115-112762137 ATGCAGTCACATTGGGAGTTAGG + Intergenic
1196206141 X:112942233-112942255 CTGTATTCTCAGTGGGAGATGGG - Intergenic
1196971184 X:121110132-121110154 CTGCAGCCACTGTGGGGGATGGG - Intergenic
1198020114 X:132649338-132649360 CTGTAGACATAGTGTGAGTCAGG + Intronic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic