ID: 999900739

View in Genome Browser
Species Human (GRCh38)
Location 5:156084120-156084142
Sequence GTGTCTACAAAAATTTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1224
Summary {0: 1, 1: 0, 2: 13, 3: 212, 4: 998}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999900739 Original CRISPR GTGTCTACAAAAATTTTGCT TGG Intronic
900283396 1:1886864-1886886 TTCTCTACAAAAAATTAGCTGGG - Intronic
900577811 1:3392704-3392726 GTGTCTTAAAGAATATTGCTGGG + Intronic
901114594 1:6832244-6832266 GTCTCTACAAAAAATTAGCCAGG - Intronic
901553464 1:10013511-10013533 GTCTCTACAAAAAATTGGCTGGG + Intronic
901561571 1:10075881-10075903 GTCTCTACAAAAAATTAGCGGGG + Intronic
901733921 1:11300089-11300111 GTCTCTACAAAAATTAGGCCGGG - Intergenic
901883252 1:12206217-12206239 GTCTCTACAAAAAATTAGCAGGG + Intronic
901921166 1:12538794-12538816 GTCTCTACAAAAAATTAGCCAGG - Intergenic
902161095 1:14530910-14530932 GTCTCTACAAAAAATTAGCCAGG + Intergenic
902281463 1:15377668-15377690 GTCTCTACAAAAAATTAGCCAGG + Intronic
902339536 1:15773972-15773994 GTGTCTACAAAAAATTAGCCGGG + Intronic
902342183 1:15791167-15791189 GTCTCTACAAAAAATTAGCCAGG + Intergenic
902447280 1:16475488-16475510 ATCTCTACAAAAAATTAGCTGGG - Intergenic
902467136 1:16625439-16625461 ATCTCTACAAAAAATTAGCTGGG - Intergenic
902507452 1:16947306-16947328 ATCTCTACAAAAAATTAGCTGGG + Intronic
902674387 1:17998560-17998582 GTCTCTACAGAAAATTAGCTGGG - Intergenic
902726514 1:18339561-18339583 GTTTCTACAAAACATTAGCTGGG + Intronic
903067555 1:20709220-20709242 GTCTCTACAAAAAATTAGCCAGG + Intronic
903091782 1:20926508-20926530 ATCTCTACAAAAAGTTAGCTGGG + Intronic
903338782 1:22641840-22641862 GTGTCCACATCGATTTTGCTGGG - Intergenic
903436066 1:23350141-23350163 GTCTCTACAAAAAATTAGCTGGG + Intergenic
903456761 1:23492776-23492798 ATCTCTACAAAAAATTTGCTGGG + Intergenic
903854646 1:26329638-26329660 GTCTCTACAAAAAATTAGCTGGG - Intronic
904595283 1:31640607-31640629 GTGTCTTCCAAAATGTGGCTTGG - Intronic
904656060 1:32048336-32048358 GTCTCTACAAAAAGTTAGCTGGG + Intronic
904743133 1:32694066-32694088 GTCTCTACAAAAAATTAGCCAGG + Intronic
904982234 1:34515715-34515737 ATTTCTACAAATATTATGCTGGG - Intergenic
905131852 1:35766913-35766935 GTTTCTACAAAAAATTAGCCGGG - Intronic
905435601 1:37953195-37953217 TTCTCTACAAAAAATTAGCTGGG + Intergenic
905728752 1:40278978-40279000 GTCTCTACAAAAAATTAGCCGGG + Intronic
905826962 1:41033121-41033143 GTCTCTGCAAAAAATTAGCTAGG + Intronic
905829088 1:41049893-41049915 ATCTCTACAGAAAATTTGCTAGG + Intronic
906287865 1:44599502-44599524 ATCTCTACAAAAAGTTAGCTGGG + Intronic
906411978 1:45585807-45585829 GTATCTACAAAAAATTGGCCAGG - Intronic
906423698 1:45691380-45691402 ATCTCTACAAAAAATTAGCTGGG + Intronic
906570238 1:46831656-46831678 GTCTCTACAAAAAATTAGCTGGG - Intergenic
906628334 1:47343905-47343927 ATCTCTACAAAAAATTAGCTGGG + Intronic
907161412 1:52372969-52372991 GTCTCTACAAAAAATCAGCTGGG + Exonic
907227348 1:52960337-52960359 GTCTCTGCAAAAAATTAGCTGGG - Intronic
907343302 1:53752817-53752839 ATCTCTACAAAAAATTAGCTGGG + Intergenic
907458010 1:54588041-54588063 GTCTCTACCAAAAATTAGCTAGG + Intronic
907477851 1:54718210-54718232 GTCTCTCCAAAAATTTAGCTGGG + Intronic
907772118 1:57475922-57475944 ATGTCTACAAACAGTATGCTCGG + Intronic
908237395 1:62159712-62159734 GTCTCTACAAAAAATTAGCCAGG - Intronic
908565955 1:65356401-65356423 GTCTCTACAAAAAATTAACTGGG + Intronic
908735476 1:67271944-67271966 GTCTCTACAAAAAATTAGCCAGG - Intergenic
908760259 1:67505269-67505291 ATCTCTACAAAAAATTAGCTGGG + Intergenic
908907526 1:69033609-69033631 GAGTATGCAAAAATTTTGCATGG - Intergenic
909622063 1:77680008-77680030 GTATCTACATAAGTTTAGCTTGG - Intronic
909634222 1:77797514-77797536 GTAACTACAAAAATTTTTCTGGG + Intronic
910196618 1:84647875-84647897 GTCTCTACAAAAAATTAGCTGGG + Intronic
911004162 1:93200143-93200165 GTCTCTACAAAAAGTTAACTGGG - Intronic
911207310 1:95104857-95104879 ATCTCTACAAAAAATTAGCTGGG + Intergenic
911207479 1:95106530-95106552 GTCTCTACCAAAAATTGGCTGGG + Intergenic
911637701 1:100253671-100253693 ATCTCTACAAAAAATTAGCTGGG + Intergenic
911905756 1:103566780-103566802 ATGTGTACAACACTTTTGCTAGG + Intronic
912020164 1:105098167-105098189 GTGTTTACAAAACTTCAGCTAGG + Intergenic
912367214 1:109144218-109144240 GTCTCTACAAAAAATTAGCCGGG - Intronic
912675354 1:111675309-111675331 GTCTCTACAAAAAATTAGCCAGG + Intronic
912756251 1:112326853-112326875 ATCTCTACAAAAAATTAGCTGGG - Intergenic
912804845 1:112747610-112747632 ATTTCTACAAAAATCTTGCTGGG + Intergenic
912917636 1:113832346-113832368 GTCTCTACTAAAAATTAGCTGGG - Intronic
914338359 1:146737593-146737615 GTCTCTACAAAAAATTAGCTGGG - Intergenic
914792344 1:150889237-150889259 GTCTCTACAAAAACTTAGCCGGG + Intergenic
914799899 1:150953221-150953243 GTGTCTAAAAAAAAATTGTTGGG + Intronic
915097852 1:153476366-153476388 GTCTCTACAAAAAATTAGCCGGG + Intergenic
916228963 1:162520059-162520081 GTTTCTACAAAAAATTAGCCAGG - Intronic
916280276 1:163043761-163043783 GTTTCTCTAAAAATTTTCCTTGG - Intergenic
917389753 1:174522406-174522428 ATCTCTACAAAAACTTAGCTGGG + Intronic
917862995 1:179165954-179165976 GTGAATACAAAAAATTAGCTGGG - Intronic
917943710 1:179948244-179948266 GTCTCTACAAAAAATTAGCTGGG - Intergenic
918053925 1:181002007-181002029 GTCTCTACAAAAAATTAGCCTGG + Intronic
918082155 1:181215988-181216010 GTCTCTACAAAAAATTTGCTGGG - Intergenic
918149649 1:181787278-181787300 GTCTCTACTAAAAATTAGCTGGG - Intronic
918411773 1:184266211-184266233 GTGCATATAAAAATTTGGCTAGG - Intergenic
918482889 1:184998521-184998543 ATATCTACAAAAAATTAGCTGGG + Intergenic
918896950 1:190360413-190360435 TTGTCTAAAACAATTTTCCTAGG - Intronic
918921471 1:190716655-190716677 GTCTCTACAAAAAATTAGCCAGG + Intergenic
919083448 1:192892367-192892389 GTCTCTACAAAAAATTAGCCAGG + Intergenic
919088454 1:192949476-192949498 GTGTCTACAAAAAACTAGCCAGG + Intergenic
919418576 1:197341965-197341987 GTGTATACAAAAACTTTGAGTGG + Intronic
919590838 1:199499892-199499914 ATGTCTAGAATAATTTTCCTAGG - Intergenic
919716476 1:200782932-200782954 ATGTCTACAAAAAATTAGCTGGG - Intronic
919904164 1:202066465-202066487 ATCTCTACAAAAAATTAGCTGGG - Intergenic
919911826 1:202115955-202115977 GTCTCCACTAAAATTTAGCTGGG - Intergenic
920148367 1:203882744-203882766 GTCTCTACTAAAAATTAGCTGGG + Intergenic
920222774 1:204416474-204416496 ATCTCTACAAAAAATTTGCCAGG + Intergenic
920327988 1:205181840-205181862 GTCTCTACAAAAAATTAGCCAGG - Intronic
920409178 1:205745326-205745348 CTGTCTACAAAAAATTAGCCAGG + Intronic
920552489 1:206874486-206874508 ATCTCTACAAAAAGTTAGCTAGG + Intergenic
921036809 1:211387405-211387427 ATGCCTACAAAAATCTTGCTTGG - Intergenic
921125511 1:212174288-212174310 GTCTCTACAAAAAATTAGCCAGG - Intergenic
921294869 1:213692232-213692254 GTCTCTACTAAAAATTAGCTGGG + Intergenic
921310120 1:213834191-213834213 ATCTCTACAAAAAATTAGCTGGG - Intergenic
921726715 1:218532731-218532753 GTCTCTACAAAAAATTAGCCAGG - Intergenic
921802020 1:219412194-219412216 GTCTCTACAAAAAATTAGCTGGG - Intergenic
921990042 1:221356173-221356195 GTGACTACATAAAGCTTGCTGGG + Intergenic
922031451 1:221803855-221803877 GTGTCTACAAAAAATTAGCTGGG - Intergenic
922227261 1:223656171-223656193 GTATTAAAAAAAATTTTGCTGGG + Intronic
922247371 1:223813610-223813632 GTGTCTAGACAAATTTTTCTAGG - Intronic
922309842 1:224378211-224378233 GTCTCTACAAAAAATTCGCTGGG - Exonic
922315949 1:224442177-224442199 GTCTCTACAAAAAGTTAGCCAGG - Intronic
922688514 1:227667202-227667224 GTCTCTACAAAAAATTAGCTGGG - Intronic
922920143 1:229295118-229295140 GTCTCTACAAAAAATTAGCCAGG - Intronic
923121504 1:230996603-230996625 GTCTCTACAAAAATTTAGCAGGG - Intronic
923135422 1:231113706-231113728 ATATCTACAAAAATATTGCTGGG - Intergenic
923574536 1:235146120-235146142 ATCTCTACAAAAAATTAGCTGGG - Intronic
923708336 1:236363993-236364015 GTCTCTACAAAAAATTAGCTGGG + Intronic
923740274 1:236648227-236648249 GTTTCTGCAAAAAATTAGCTGGG + Intergenic
923856849 1:237854454-237854476 GTCTCTACTAAAAATTAGCTGGG - Intergenic
924114474 1:240731520-240731542 GTCTCTACAAAATATTAGCTAGG + Intergenic
924361808 1:243249255-243249277 ATCTCTACAAAAAATTAGCTGGG + Intronic
1062891715 10:1066566-1066588 ATATCTACAAAAATCTTGCTGGG - Intronic
1063256747 10:4336770-4336792 TTATCTACAAAAATTTTGTGTGG - Intergenic
1063632385 10:7746212-7746234 GTCTCTACAAAAAATTAGCCAGG + Intronic
1063702828 10:8402118-8402140 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1063923136 10:10951302-10951324 GTCTCTACAAAAATATAGCTGGG - Intergenic
1064026247 10:11851053-11851075 GTCTCTACAAAAAATAAGCTGGG + Intronic
1064387528 10:14910463-14910485 CTGTCTAAAAAAAATTAGCTGGG - Intronic
1064453557 10:15465755-15465777 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1065114293 10:22469450-22469472 GTCTGTACAAAAAATTAGCTGGG + Intergenic
1065185827 10:23170582-23170604 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1065333692 10:24631887-24631909 GTCTCTACAAAAAATTAGCTGGG - Intronic
1065410419 10:25420986-25421008 GTTTCTACAAAACTATTGCTGGG + Intronic
1066076031 10:31877921-31877943 GTCTCTACAAAAAATTAACTGGG + Intronic
1066100944 10:32117966-32117988 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1066207946 10:33208219-33208241 GTCTCCACAAAAAATTAGCTCGG - Intronic
1067229615 10:44397271-44397293 GTGTCTACAAACCTTTTGCGAGG + Intergenic
1067341283 10:45406643-45406665 CTGTTTGCAAAAATATTGCTGGG + Intronic
1067360818 10:45576574-45576596 GTGTATACATAGATGTTGCTAGG + Intronic
1067424940 10:46201084-46201106 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1068207050 10:53868974-53868996 GTGTCTACAAAGAATTAGCCAGG - Intronic
1068459108 10:57303194-57303216 GTGCATAAAAATATTTTGCTAGG + Intergenic
1069051935 10:63804098-63804120 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1069485355 10:68819092-68819114 ATATCTACAAAAAATTAGCTGGG - Intergenic
1069494299 10:68889139-68889161 ATCTCTACAAAAAATTAGCTGGG - Intronic
1069662718 10:70134176-70134198 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1070200077 10:74195970-74195992 ATCTCTACAAAAAATTGGCTGGG - Intronic
1070208387 10:74287819-74287841 ATCTCTACAAAAAATTAGCTGGG + Intronic
1070286895 10:75090127-75090149 GTCTCTACAAAAAGTCAGCTGGG + Intergenic
1070624296 10:78038798-78038820 GTCTCTACAAAAAATTGGCAGGG - Intronic
1070949241 10:80417876-80417898 CTGTCTATAAAAAATTAGCTGGG - Intronic
1071303781 10:84279274-84279296 ATAGCTACAAACATTTTGCTAGG - Intergenic
1071460821 10:85893814-85893836 GTTTCTAGAAAAATCCTGCTAGG - Intronic
1071697445 10:87891643-87891665 GTCTTTACAAAAAATTAGCTGGG + Intronic
1072099778 10:92217947-92217969 GTTTCTACAAAAAATTATCTGGG + Intronic
1072301240 10:94064380-94064402 GTCTCTACAAAAAATTAGCTGGG + Intronic
1072440507 10:95449944-95449966 GTATCTAAAAATATTTTTCTTGG - Intronic
1072639696 10:97202531-97202553 ATCTCTACAAAAAATTAGCTGGG - Intronic
1072640637 10:97208587-97208609 ATCTCTACAAAAAATTAGCTAGG + Intronic
1072879134 10:99206430-99206452 ATGTCTACAAAAAATTAGCCGGG + Intronic
1072900211 10:99400475-99400497 GTTTCTACAAAAAATTAGCCGGG + Intronic
1072918990 10:99559650-99559672 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1073114002 10:101080764-101080786 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1073164766 10:101436474-101436496 GTCTCTACAAAAAATTAGCTGGG + Intronic
1073216006 10:101836659-101836681 GTCTCTACAAAAAATTAGCCTGG + Intronic
1073277095 10:102321728-102321750 GTCTCTACAAAAAATTAGCCAGG - Intronic
1073496870 10:103899524-103899546 ATCTCTACAAAAAATTAGCTGGG + Intronic
1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG + Intergenic
1074031320 10:109691497-109691519 TAGCCTATAAAAATTTTGCTTGG - Intergenic
1074173615 10:110972674-110972696 GTCTCTACAAAAAATTAGCTGGG + Intronic
1074456721 10:113602044-113602066 GTCTCTACAAAAAATTAGCTGGG - Intronic
1075019070 10:118935497-118935519 ATGTCTATAAAATTCTTGCTGGG - Intergenic
1075252366 10:120891610-120891632 GTGTGCACCAAAGTTTTGCTGGG - Intronic
1075309387 10:121399999-121400021 GTATCTACAAAAAACTTGCTAGG - Intergenic
1075368662 10:121916064-121916086 GTCTCTACAAAAAATTAGCCGGG + Intronic
1075988679 10:126813702-126813724 GTCTCTACAAAAAGTAAGCTGGG - Intergenic
1076054301 10:127358761-127358783 GTGTATACAGAGATTTTTCTGGG + Intronic
1076075083 10:127527254-127527276 ATGTCTACAAGAATATTCCTGGG - Intergenic
1076573497 10:131448692-131448714 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1077268389 11:1663716-1663738 GTTTCAACAAGAGTTTTGCTGGG - Intergenic
1077272490 11:1687902-1687924 GTTTCAACAAGAGTTTTGCTGGG + Intergenic
1077381704 11:2245447-2245469 GTTTCTACAGAAAGCTTGCTGGG - Intergenic
1077448053 11:2611378-2611400 GTCTCTACTAAAAATTAGCTGGG - Intronic
1078375341 11:10788775-10788797 GTCTCTACAAAAAATTAGCCGGG + Intergenic
1078403762 11:11049685-11049707 TTATCTACAAAAATCTTGTTGGG + Intergenic
1078416111 11:11167145-11167167 GTGTATACAAATTTTTTTCTTGG - Intergenic
1078503416 11:11907925-11907947 GTCTCTACTAAAAATTAGCTGGG + Intronic
1079647715 11:22887873-22887895 TTATCTACAAAAATCTTGCTGGG - Intergenic
1080048163 11:27831229-27831251 TTGGCTACAAAAGGTTTGCTGGG + Intergenic
1080554233 11:33401720-33401742 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1080617013 11:33953362-33953384 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1080829522 11:35878378-35878400 GTCTCTGCAAAAAATTAGCTGGG + Intergenic
1080859448 11:36140587-36140609 ATCTCTACAAAAAATTAGCTGGG - Intronic
1081756274 11:45546989-45547011 GGCTCTACAAAAAATTAGCTGGG + Intergenic
1081916982 11:46738632-46738654 CTCTCTACAAAAAATTAGCTGGG - Intronic
1082074424 11:47965235-47965257 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1082839874 11:57680214-57680236 GTCTCTACAAAAAATTAGCCGGG + Intronic
1082868777 11:57924100-57924122 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1083111455 11:60412871-60412893 ATTGCTACAAAAATCTTGCTGGG + Intronic
1083294757 11:61709402-61709424 GTCTCTACAAAAAATTAGCGGGG - Intronic
1083573928 11:63775714-63775736 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1083755882 11:64791537-64791559 GACTCTACAAAAAATTAGCTGGG - Intronic
1083818548 11:65151997-65152019 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1085319966 11:75568126-75568148 ATGTCTACAAAAAATTAGCCAGG + Intronic
1085357365 11:75850787-75850809 GTATTTACAAAAAGTTTCCTGGG - Intronic
1085590392 11:77754571-77754593 GTCTCTACAAAAAATTAGCCAGG + Intronic
1085691098 11:78664392-78664414 ATCTCTACAAAAAATTAGCTAGG - Intronic
1085711853 11:78836187-78836209 GTTTCTACAAAAAATTAGCTGGG + Intronic
1085896123 11:80641725-80641747 GTCTCTACTAAAAATTGGCTAGG + Intergenic
1086099883 11:83088190-83088212 GTCTCTACAAAAACTTAGCCAGG - Intergenic
1086380635 11:86248848-86248870 GTCTCTACCAAAAATTAGCTGGG + Intronic
1086736597 11:90314367-90314389 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1087178127 11:95114275-95114297 GTCTCTACAAAAAATTAGCTAGG - Intronic
1087466238 11:98510123-98510145 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1087941211 11:104099469-104099491 GTCTCTACAAAAAATTAGCCAGG + Intronic
1088314135 11:108490045-108490067 ATCTCTACAAAAAATTAGCTGGG - Intronic
1088645933 11:111916389-111916411 GTCTCTACAAAAAATTAGCCAGG - Intronic
1089122836 11:116151414-116151436 GTATCTGCAAAAATATGGCTAGG - Intergenic
1089236315 11:117029294-117029316 GGATCTACAAAAAATTAGCTGGG + Intronic
1090368317 11:126226810-126226832 GTGTCTACAAAAAATTAGCCAGG + Intronic
1090730238 11:129567155-129567177 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1090778477 11:129985621-129985643 GTCTCTACAAAAAGTTAGCCAGG + Intronic
1090833052 11:130432872-130432894 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1091499818 12:1005309-1005331 ATCTCTACAAAAAATTAGCTGGG - Intronic
1091809437 12:3383243-3383265 ATATCTATAAAAATCTTGCTGGG + Intronic
1092374926 12:7947493-7947515 GTCTCTGCAAAAAATTAGCTGGG - Intergenic
1092632971 12:10405116-10405138 GTCTCTTCAAAAATAATGCTGGG + Intronic
1092888591 12:12947723-12947745 GTCTCTACAAAAAATTAGCTGGG - Intronic
1093500296 12:19804475-19804497 ATGTCTACAAAAAAATTGCTGGG - Intergenic
1093805203 12:23423751-23423773 GTGTTTACAAAAATTTTAGCTGG + Intergenic
1093949410 12:25147485-25147507 ATCTCTACAAAAAATTAGCTGGG + Intronic
1094012415 12:25823365-25823387 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1094118511 12:26943465-26943487 TTCTCTAAAAAAATCTTGCTGGG + Intronic
1094665340 12:32514882-32514904 ATATCTACAAAAAATTAGCTAGG - Intronic
1095304797 12:40626517-40626539 GTCTCTACAAAAAATTTGCTGGG + Intergenic
1095353719 12:41245484-41245506 GTGTATACAAAACTTTTTATAGG - Intronic
1095533332 12:43216988-43217010 GTGTCTAAAAAAATTTTTACCGG - Intergenic
1095770869 12:45955315-45955337 ATCTCTACAAAAAATTAGCTGGG - Intronic
1096163918 12:49404445-49404467 GTCTTTACAAAAAATTAGCTGGG - Intronic
1096170942 12:49469227-49469249 GTCTCTACCAAAAATTAGCTGGG + Intronic
1096645918 12:53035672-53035694 ATCTCTACAAAATTTTAGCTGGG - Intronic
1096647387 12:53046321-53046343 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1096762940 12:53858498-53858520 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1096811945 12:54176349-54176371 GTCTCTACAAAAAATTAGCCAGG + Intronic
1096830449 12:54309785-54309807 GTCTCTACAAAAAATTAGCCTGG - Intronic
1096855845 12:54482011-54482033 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1096957262 12:55539414-55539436 ATGTCTACAAAAAATTAGCTGGG - Intergenic
1097348944 12:58526242-58526264 GTGTCTACAACTATATTTCTTGG - Intergenic
1097819945 12:64118428-64118450 ATCTCTACAAAAAATTAGCTGGG - Intronic
1097958386 12:65509408-65509430 GTGTCTGCAAAAACACTGCTTGG + Intergenic
1097978958 12:65717575-65717597 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1098085497 12:66838023-66838045 GTGCCTACTAAAAATTAGCTGGG + Intergenic
1098209297 12:68146415-68146437 GTATCTACAAAATACTTGCTGGG + Intergenic
1098257235 12:68629145-68629167 GTCTCTACAAAAAATTACCTGGG - Intronic
1098354156 12:69594684-69594706 GTCTCTACAAAAAATTAGCTGGG + Intronic
1098428883 12:70397187-70397209 TTCTCTACAAAAAATTAGCTGGG + Intronic
1098942074 12:76549569-76549591 GTCTCTACTAAAAATTAGCTGGG - Intronic
1099945781 12:89242626-89242648 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1100061054 12:90575899-90575921 GTGTCTAGAAATATTTTCCAGGG + Intergenic
1100141303 12:91621957-91621979 GTGTCTACTAAAAATGTCCTTGG - Intergenic
1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG + Intergenic
1100952682 12:99869186-99869208 ATTTCCACAAAAATTCTGCTGGG - Intronic
1100988931 12:100231439-100231461 ATCTCTACAAAAAATTTGCCAGG - Intronic
1101173296 12:102121712-102121734 CTGTCTACTAAAAATTAGCTGGG - Intronic
1101359628 12:104014192-104014214 ATTTCTACAAAAAATTAGCTGGG + Intronic
1101774343 12:107779970-107779992 CTGTCTACAAAAAATTAGCCAGG + Intergenic
1101955437 12:109208374-109208396 GTCTCTACAAAAAATTAGCTGGG - Intronic
1102051753 12:109867442-109867464 GTATCTATAAGAATTTGGCTGGG - Intronic
1102642667 12:114380667-114380689 GTCGCTACAAAAAATTAGCTGGG + Intronic
1102689592 12:114750035-114750057 ATCTCTACAAAAACTTAGCTGGG + Intergenic
1102834482 12:116041672-116041694 GTCTCTACCAAAAATTAGCTGGG + Intronic
1102954492 12:117050762-117050784 GTCTCTACAAAAAATTAGATGGG + Intronic
1102981407 12:117244405-117244427 GTCTCTACTAAAAATTAGCTGGG - Intronic
1103030774 12:117610577-117610599 GTCTCTACAAAAATTTAGCCTGG + Intronic
1103432218 12:120898141-120898163 ATGTCTACAAAAAATTAGCTGGG + Intronic
1103526607 12:121573441-121573463 CTCTCTACAAAAAATTAGCTGGG - Intronic
1103689708 12:122761649-122761671 GTCTCTACAAAAAATTAGCTGGG + Intronic
1103692927 12:122790495-122790517 GTCTCTACAAAAAATTAGCCAGG + Intronic
1104012927 12:124944759-124944781 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1104691197 12:130827743-130827765 GTCTCTACAAAAAATTAGCTGGG + Intronic
1104723903 12:131063812-131063834 GTGTCTACAAAAATTCTTGCTGG + Intronic
1104734237 12:131127132-131127154 TTTTCTCCAAAGATTTTGCTGGG - Intronic
1104824225 12:131696968-131696990 GCCTCTACAAAAAATTAGCTGGG + Intergenic
1105327053 13:19380302-19380324 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1105374420 13:19830692-19830714 GTCTCTACAAAAAATTAGCCAGG - Intronic
1105864593 13:24448034-24448056 GTCTCTACAGAAAATTAGCTGGG + Intronic
1106746226 13:32711151-32711173 GTCTCTACAAAAAATTAGCCGGG - Intronic
1106807511 13:33325822-33325844 GTCTCTACAAAAAATTAGCCGGG + Intronic
1106995725 13:35478063-35478085 GTGTCTACAAACATGTTACCGGG - Intronic
1107321405 13:39192603-39192625 GTCTCTACAAAAAATCAGCTGGG + Intergenic
1107355909 13:39566570-39566592 GTCTCTACAAAAAATTAGCTGGG + Intronic
1107475413 13:40731091-40731113 GTCTCTACAAAAAATTAGCCAGG + Intronic
1107748767 13:43542300-43542322 GTCTCTACAAAAAATTAGCCGGG - Intronic
1108604069 13:52019770-52019792 GTCTCTACAAAAAATTATCTGGG + Intronic
1109668168 13:65566544-65566566 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1110194614 13:72773299-72773321 ATGTCTACTAAAAATTAGCTGGG + Intronic
1110215769 13:73023287-73023309 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1110352745 13:74528700-74528722 GTTCCCATAAAAATTTTGCTGGG + Intergenic
1110966931 13:81711891-81711913 GTGGCTACAAAATTTTTGGTTGG + Intergenic
1111516808 13:89343967-89343989 CTTTCTACAAAAAAATTGCTAGG - Intergenic
1111553179 13:89843520-89843542 GTGTATACATAAATTATGCCTGG + Intergenic
1112242886 13:97699671-97699693 ATCTCTACAAAAACTTAGCTGGG + Intergenic
1112319153 13:98391437-98391459 ATCTCTACAAAAATTTAGCTGGG - Intronic
1112488433 13:99840587-99840609 GTCTCTACAAAAAATTAGCCAGG + Intronic
1113846022 13:113392206-113392228 ATCTCTACAAAAAGTTAGCTGGG - Intergenic
1113924487 13:113933526-113933548 ATTTCTACAAAAATCCTGCTGGG + Intergenic
1114040506 14:18673985-18674007 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1114045543 14:18872498-18872520 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1114118669 14:19646970-19646992 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1114302209 14:21388650-21388672 ATCTCTACAAAAAATTAGCTGGG - Intronic
1114461478 14:22888684-22888706 GTCTTTACAAAAAATTAGCTGGG + Intergenic
1114590246 14:23857945-23857967 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1114852623 14:26399628-26399650 ATTTCTACAAAAATTCTGCAGGG + Intergenic
1115006737 14:28494707-28494729 ATGTCTACAAAAATCTTGCCGGG - Intergenic
1115006824 14:28496192-28496214 GTCTCTACAAAAAAATAGCTTGG - Intergenic
1115111675 14:29830851-29830873 GTTTCTACAAAAAATTAGTTGGG - Intronic
1115138875 14:30144809-30144831 GTCTCTACAAAAAATTAGCCAGG + Intronic
1115549300 14:34490823-34490845 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1115708535 14:36024672-36024694 GTGGTTACAAAAATATAGCTAGG - Intergenic
1115870449 14:37795172-37795194 CTTTCTACAGAAATTTTGCAGGG - Intronic
1116025268 14:39506987-39507009 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1116315815 14:43390439-43390461 GTCTCTACAAAAAATTAGCGGGG + Intergenic
1116716174 14:48430254-48430276 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1116888755 14:50246601-50246623 GTTTCTACACAAAGTTAGCTGGG - Exonic
1117113900 14:52489995-52490017 ATCTCTACAAAAAATTGGCTGGG - Intronic
1117154124 14:52920782-52920804 ATCTCTACAAAAAATTAGCTGGG + Intronic
1117368436 14:55053422-55053444 GTGCCTAAAAAAATAGTGCTTGG - Intronic
1117375337 14:55113826-55113848 GTCTCTACAAAAAATTAGCCGGG - Intergenic
1117388271 14:55238388-55238410 GTCTCTACAAAAAATTAGTTGGG - Intergenic
1117685584 14:58249672-58249694 GTCTCTACAAAAAATTTGCCAGG - Intronic
1117696691 14:58371724-58371746 TTGTCAGCAAAAATTTTGTTTGG - Intronic
1117777970 14:59201452-59201474 GTCTCTACTAAAAATTAGCTGGG + Intronic
1118619887 14:67605104-67605126 TTTTCACCAAAAATTTTGCTTGG + Intergenic
1118632772 14:67721412-67721434 GTCTCTACAAAAAATTATCTGGG - Intronic
1118866402 14:69707585-69707607 GTCTCTACAAAAAATTGGCCAGG + Intronic
1118997814 14:70853189-70853211 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1119047983 14:71337783-71337805 GTCTCTACAAAAAATAAGCTAGG + Intronic
1119249287 14:73137905-73137927 GGCTCTACAAAAAATTAGCTGGG + Intronic
1119323112 14:73743198-73743220 GTGTCTAGAAAATCCTTGCTTGG - Intronic
1119437464 14:74606676-74606698 GTCTCTACTAAAAATTAGCTGGG + Intronic
1119551482 14:75517123-75517145 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1119581760 14:75790631-75790653 TTCTCTACAAAAACTTAGCTGGG - Intronic
1119601713 14:75981134-75981156 GTGTCTAAACAGGTTTTGCTGGG + Exonic
1119737354 14:76991736-76991758 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1120273747 14:82347174-82347196 GTTTCTACAAAAAATTAGCCAGG - Intergenic
1120372126 14:83649767-83649789 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1120977844 14:90265383-90265405 GTCTCTATAAAAAATTAGCTGGG + Intronic
1121294244 14:92804814-92804836 GTTTCTACTAAAAATTAGCTGGG - Intronic
1122166974 14:99833504-99833526 GTTTCTACAAAAATCCTGCTGGG + Intronic
1122176595 14:99925418-99925440 GTCTCTAAAAAAAATTAGCTGGG - Intronic
1122557059 14:102586302-102586324 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1122674995 14:103405509-103405531 GTCTCTACAAAAAATTAGCTGGG - Intronic
1122701266 14:103590697-103590719 GTCTCTACAAAAAATTAGCTGGG + Exonic
1125569385 15:40704232-40704254 GTCTCTACTAAAAATTAGCTGGG - Intronic
1125739857 15:41954796-41954818 GTTTCTACAAAAAATTAGCTAGG - Intronic
1125851281 15:42905424-42905446 GTATCTCCAAAAATTTAGCTAGG - Intronic
1125859882 15:42988453-42988475 TTGTCTACAAAAAATTAGCCAGG - Intronic
1125963374 15:43851899-43851921 GTCTCTAAAAAAAATTAGCTTGG + Intronic
1126042279 15:44603259-44603281 GTCTCTACAAAAAATTAGCCGGG - Intronic
1126575669 15:50193988-50194010 ATCTCTACAAAAAGTTAGCTGGG + Intronic
1126796725 15:52265697-52265719 ATCTCTACAAAAAATTAGCTGGG - Intronic
1126949846 15:53868946-53868968 ATGTCTACAAAAAATTTAGTCGG + Intergenic
1127150904 15:56074302-56074324 GTCTCTACAGAAAATTAGCTGGG + Intergenic
1127156460 15:56131425-56131447 GTCTCTACAAAAAATTAGCTGGG - Intronic
1127175833 15:56355635-56355657 ATTTCTACAAAAGTTTTGCTAGG + Intronic
1127253442 15:57266866-57266888 GTCTCTACAAAAAATTAGCGGGG + Intronic
1127297221 15:57619536-57619558 GTCTCTACAAAAAATTATCTGGG - Intronic
1127440608 15:59003271-59003293 GTCTCTACAAAAACTTAGCTGGG - Intronic
1127800180 15:62471174-62471196 GCCTCTACAAAAAATTAGCTGGG + Intronic
1128137748 15:65276532-65276554 GTCTGTACAAAAAATTAGCTGGG - Intronic
1128142321 15:65310861-65310883 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1128189844 15:65681734-65681756 GTCTCTACAAAAAATTAGCTGGG - Intronic
1128303208 15:66580404-66580426 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1128307172 15:66606386-66606408 ATCTCTACAAAAAATTAGCTGGG + Intronic
1129022076 15:72529396-72529418 ATCTCTACAAAAAATTTGCTAGG - Intronic
1129103715 15:73290399-73290421 GTGTCTACAAAAAACTAGCCAGG - Intronic
1129432089 15:75506668-75506690 GTTACTACAAAAAATTAGCTGGG - Intronic
1129448119 15:75633129-75633151 GTCTCTACAAAAAATTGGCCGGG - Intergenic
1129753783 15:78083708-78083730 ATCTCTACAAAAAATTAGCTGGG + Intronic
1129806676 15:78467047-78467069 GTGTCTACAAAAAATTACCCGGG + Intronic
1129854829 15:78815945-78815967 GTCTCTACAAAAAATTAGCTGGG + Intronic
1129863618 15:78884341-78884363 GTCTCTACTAAAAATTAGCTGGG + Intronic
1130246754 15:82258388-82258410 GTCTCTACAAAAAATTAGCCAGG + Intronic
1130351640 15:83097581-83097603 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1130570861 15:85042333-85042355 GTCTCTACAAAAAATTAGCTGGG - Intronic
1131328700 15:91474373-91474395 GTGTCTACAAAAATTTCTATTGG + Intergenic
1131691683 15:94834103-94834125 GCTTCTACAAAAATGTTACTAGG + Intergenic
1132083663 15:98888463-98888485 GTGTTTACAGAAAATATGCTAGG + Intronic
1132104372 15:99052028-99052050 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1132235593 15:100218039-100218061 GTATCTACAGAAAATTAGCTGGG - Intronic
1132820061 16:1861701-1861723 ATTTCTACAAAAAATTAGCTGGG - Intronic
1133046488 16:3091149-3091171 CTCTCTACAAAAAGTTAGCTGGG + Intronic
1133163834 16:3932313-3932335 GTTTCTACAAAAAATTAGCTGGG + Intergenic
1133182061 16:4064340-4064362 ATTTCTACAAAAAGCTTGCTGGG - Intronic
1133183015 16:4073253-4073275 GTCTCTACCAAAAATTAGCTGGG - Intronic
1133484923 16:6210559-6210581 GTCTCTACAAAAAATTAGCTGGG + Intronic
1133733705 16:8597538-8597560 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1134079264 16:11313896-11313918 GTCTCTACAAAAAATTAGCTGGG - Intronic
1134137198 16:11685193-11685215 GTCTCTACAAAAAATTGGCCGGG + Intronic
1134257846 16:12626334-12626356 GTCTCTACTAAAAATTAGCTAGG + Intergenic
1134446758 16:14336940-14336962 GTCTCTACCAAAAATTAGCTGGG - Intergenic
1134661851 16:15990213-15990235 GTCTCTACTAAAAATTAGCTGGG - Intronic
1134811312 16:17169225-17169247 GAGGCTACAAAAAGTATGCTGGG + Intronic
1135148629 16:19985749-19985771 GTCTCTACAAAAAATTTGCCAGG - Intergenic
1135164664 16:20128541-20128563 TTCTCTACAAAAAATTAGCTGGG - Intergenic
1135292165 16:21249313-21249335 GTCTCTACAAAAAATTAGCTAGG + Intronic
1135344992 16:21681420-21681442 ATCTCTACAAAAAATTAGCTGGG + Intronic
1135415996 16:22268337-22268359 GTCTCTACTAAAAATTAGCTGGG - Intronic
1135515713 16:23131451-23131473 TCTTCTACAAAAATTTGGCTGGG - Intronic
1135542361 16:23341010-23341032 ATTTCTACAAAAATTCTGCTAGG + Intronic
1135645694 16:24159823-24159845 ATCTCTACAAAAAATTAGCTAGG + Intronic
1135982689 16:27160651-27160673 GTCTCTATAAAAAATTAGCTGGG - Intergenic
1136162423 16:28429132-28429154 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1136183230 16:28569489-28569511 GTCTCTACAAAAAATTAGCCGGG + Intronic
1136200543 16:28685857-28685879 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1136216888 16:28800050-28800072 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1137416487 16:48286663-48286685 GTCTCTACAAAAAATTGGCCAGG - Intronic
1137659541 16:50192911-50192933 GTCTCTACAAAAAATTAGCTGGG + Intronic
1138020543 16:53475990-53476012 GTATCTACAAAAAATTAGCAGGG - Intronic
1138147419 16:54625053-54625075 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1138180098 16:54935362-54935384 GTAGCTACAAAAATATTTCTGGG + Intergenic
1138407138 16:56805216-56805238 CTCTCTACAAAAAGTTAGCTGGG - Intronic
1138476838 16:57275945-57275967 GTCTCTACCAAAAATTAGCTGGG + Intronic
1138610316 16:58118309-58118331 GTTTCTACAAAAAATTAGCCAGG + Intronic
1139290885 16:65856783-65856805 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1139565848 16:67775642-67775664 GTCTCTACAAAAAATTAGGTGGG + Intronic
1139995919 16:70979761-70979783 GTCTCTACAAAAAATTAGCTGGG + Intronic
1140357354 16:74317989-74318011 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1140415377 16:74770537-74770559 GTCTCTACAAAAAATTAGCTGGG - Intronic
1140488607 16:75315170-75315192 GTCTCTACAAAAAATTTGCCGGG + Intronic
1140652200 16:77100313-77100335 GTGTCTTCAAATTATTTGCTAGG - Intergenic
1140683316 16:77407428-77407450 ATTTCTACCAAAATTCTGCTGGG - Intronic
1141018983 16:80477414-80477436 ATGTCTACTAAAAATTAGCTGGG - Intergenic
1141056938 16:80826271-80826293 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1142384065 16:89751329-89751351 GTCTCTACAAAAAATCAGCTGGG + Intronic
1142573498 17:891233-891255 ATTTCTACAAAAAATTAGCTGGG - Intronic
1142580480 17:938889-938911 GTCTCTACTAAAAATTAGCTGGG + Intronic
1142661765 17:1435218-1435240 ATCTCTACAAAAAATTAGCTGGG - Intronic
1142800136 17:2339551-2339573 CTCTCTACAAAAAATTAGCTGGG + Intronic
1142819777 17:2456635-2456657 GTGTCTACAAAAAATCAGCCTGG - Intronic
1142879419 17:2872829-2872851 GTCTCTACAAAAACTTTGCCAGG - Intronic
1142891105 17:2943502-2943524 GTCTCTACTAAAAATTAGCTGGG + Intronic
1143231167 17:5356809-5356831 GTCTCTACAAAAAATTAGCTGGG - Intronic
1143657384 17:8303555-8303577 GTCTCTACAAAAAGTTAGCCAGG + Intergenic
1143705045 17:8691555-8691577 GTTTCTACAAAAAATTAGCAGGG - Intergenic
1143819904 17:9552179-9552201 ATCTCTACAAAAAATTAGCTGGG + Intronic
1144396445 17:14848440-14848462 ATCTCTACAAAAAATTAGCTAGG - Intergenic
1144553120 17:16258853-16258875 GCCTCTACAAAAATTGTACTGGG + Intronic
1144588968 17:16507761-16507783 GTCTCTATGAAAAATTTGCTGGG - Intergenic
1144645197 17:16968470-16968492 GTGTTTTCAAAAATGATGCTGGG + Intronic
1144748605 17:17633089-17633111 GTGTTTACAAACCTTTAGCTAGG + Intergenic
1144868468 17:18352657-18352679 GTCTCTACAAAAAATTAGCTGGG + Intronic
1145036869 17:19547210-19547232 ATCTCTACAAAAAATTAGCTGGG - Intronic
1145201664 17:20951052-20951074 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1145748484 17:27338197-27338219 GTCTCTACTAAAAATTGGCTGGG + Intergenic
1145789739 17:27618856-27618878 ATGTATACAAAAATTTTTTTTGG - Intronic
1145824730 17:27868340-27868362 GTCTCTACAAAAATATTGGCTGG + Intronic
1145876675 17:28323835-28323857 GTCTCTACAGAAAATTAGCTGGG + Intronic
1145911004 17:28543107-28543129 ATCTCTACAAAAAATTAGCTGGG + Intronic
1145985033 17:29040114-29040136 GTCTCTACAAAAAATAAGCTGGG + Intronic
1146078370 17:29754825-29754847 GTCTTTACAAAAAATTAGCTGGG - Intronic
1146120387 17:30188821-30188843 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1146204271 17:30888381-30888403 ATCTCTACAAAAAATTGGCTGGG + Intronic
1146243389 17:31252539-31252561 GTGTCTACATAATTTTTTCTTGG - Intronic
1146325663 17:31883835-31883857 GTCTCTACAAAAAATAAGCTAGG - Intronic
1146388167 17:32396264-32396286 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1146396272 17:32470171-32470193 ATCTCTACAAAAAGTTAGCTTGG - Intronic
1146435853 17:32846803-32846825 TTGTTTAAAAAAATTTAGCTGGG - Intronic
1146522476 17:33536836-33536858 GTCTCTACAAAAAATTAGCCAGG + Intronic
1146734703 17:35228442-35228464 GTCTCCACAAAAATTTAGCCAGG - Intergenic
1147016737 17:37497883-37497905 GTCTCTACAAAAAATTAGCCAGG + Intronic
1147188069 17:38723329-38723351 GTCTCTACAAAAAATTAGCTGGG + Intronic
1147416222 17:40292195-40292217 GTCTCTACAAAAAATTAGCTGGG - Intronic
1147680893 17:42244687-42244709 TTGTCAAAGAAAATTTTGCTAGG - Intronic
1147794995 17:43035963-43035985 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1147818307 17:43226178-43226200 GTCTTTACAAAAAATTAGCTAGG + Intergenic
1147932533 17:43991661-43991683 ATCTCTACAAAAAATTGGCTGGG + Intronic
1147998166 17:44372787-44372809 GTCTCTACTAAAAATTAGCTGGG - Intronic
1148033497 17:44639648-44639670 ATCTCTACAAAAATTTAGCTGGG - Intergenic
1148404582 17:47399081-47399103 GTCTCTACAAAAAATTAGCCAGG - Intronic
1148620099 17:49028000-49028022 ATGTCTACAAAAAATTAGCTGGG + Intronic
1148738446 17:49878365-49878387 GATTCTACAAAAAATTAGCTGGG + Intergenic
1149662665 17:58343372-58343394 ATCTCTACAAAAAATTAGCTAGG - Intergenic
1149673094 17:58433167-58433189 GTCTCTACAAAAAACATGCTTGG - Intronic
1149697543 17:58628114-58628136 GAGTCTAGAAAAATTCTGCAAGG + Intronic
1149820383 17:59771331-59771353 GCCTCTACAAAAAATTAGCTTGG - Intronic
1150014666 17:61542097-61542119 GTCTCTACAAAAATTATCCGTGG - Intergenic
1150052060 17:61974241-61974263 GTCTCTACAAAAAGTTAGCTGGG + Intronic
1150192771 17:63260614-63260636 GTCTCTACAAAAAATTAGCCAGG + Intronic
1151500673 17:74486358-74486380 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1151650061 17:75461751-75461773 GTCTCTACTAAAAATTAGCTGGG + Intronic
1151779765 17:76237782-76237804 GTCTCTACAAAAAACTTGCCTGG + Intronic
1151927242 17:77207389-77207411 GCCTCTACAAAAAATTCGCTGGG - Intronic
1151931540 17:77235118-77235140 CTCTCTACAAAAAATTAGCTGGG + Intergenic
1152131856 17:78482211-78482233 GTCTCTACAAAAACTTAGCCGGG - Intronic
1152150834 17:78600036-78600058 GTCTCTACAAAAAATTAACTGGG - Intergenic
1152219783 17:79056980-79057002 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
1152475609 17:80516165-80516187 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1153170588 18:2311594-2311616 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1153973143 18:10244685-10244707 GTGGCTACAAAACTCTTGCAAGG - Intergenic
1154222965 18:12473088-12473110 ATCTCTACAAAAATTTGGCTGGG - Intronic
1155206586 18:23563580-23563602 ATCTCTACAAAAACTTAGCTGGG - Intronic
1155265883 18:24092913-24092935 ATTTCTACAAAAAATTAGCTGGG + Intronic
1155550173 18:26956149-26956171 GTCTCTACTAAAAATTAGCTGGG + Intronic
1156013190 18:32517397-32517419 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1156017384 18:32561368-32561390 GTCTCTACAAAAAATTTACCAGG - Intergenic
1156435604 18:37125157-37125179 GTTTCTACAAAAAATTAGCCAGG + Intronic
1156686266 18:39650768-39650790 GTCTCTACTAAAAATTAGCTAGG - Intergenic
1156757470 18:40545927-40545949 GAATCTACATTAATTTTGCTTGG - Intergenic
1157665203 18:49480155-49480177 GTCTCTACAAAAAATTAGCCAGG + Intronic
1158107121 18:53898593-53898615 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1158249952 18:55476634-55476656 GTCTCTACAAAAAATTCACTGGG - Intronic
1158262689 18:55626335-55626357 GTTTCTAGATAAATTTAGCTGGG - Intronic
1158433332 18:57412948-57412970 GTATCTACAAAAATCTTGCTGGG - Intergenic
1158525831 18:58212637-58212659 GTCTCCACAAAAAATTGGCTAGG - Intronic
1158733965 18:60058287-60058309 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1159522561 18:69544958-69544980 ATCTCTACAAAAAATTAGCTGGG + Intronic
1159956901 18:74525098-74525120 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1160204153 18:76819780-76819802 ATCTCTACAAAAAATTAGCTGGG - Intronic
1160204200 18:76820307-76820329 ATGTCCACAAAAAATTAGCTAGG + Intronic
1160282527 18:77505330-77505352 ATACCTACAAATATTTTGCTGGG + Intergenic
1160445166 18:78921968-78921990 ATGTCTTCAAATATTTAGCTTGG - Intergenic
1160924290 19:1535712-1535734 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1161210878 19:3064846-3064868 GTGTCTGAAAAAATTTTTTTAGG - Intergenic
1161369650 19:3903524-3903546 GTCTCCAAAAAAATTTTGTTTGG - Intronic
1161376888 19:3943963-3943985 GTTTCTACAAAAAATTAGCCAGG + Intergenic
1161466798 19:4435536-4435558 GTTTCTACAGAAAATTAGCTGGG - Intronic
1161750314 19:6091320-6091342 GTCTCTACAAAAAATTAGCCAGG + Intronic
1161792183 19:6366797-6366819 GTCTCTACAAAAAATTAGCCAGG - Intronic
1161823044 19:6542845-6542867 GTCTCTGCAAAAAATTAGCTGGG + Intergenic
1162337073 19:10068346-10068368 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1162465620 19:10837958-10837980 ATGTCTACAAAAAATTAGTTAGG - Intronic
1162560031 19:11411781-11411803 GTGTCTACAAATAATTAGCTGGG - Intronic
1162574604 19:11491745-11491767 GTCTCTACTAAAAATTAGCTGGG - Intronic
1162671954 19:12265235-12265257 CTCTCTACAAAAAATTAGCTGGG + Intronic
1162719657 19:12654832-12654854 GTCTCTACAAAAAATTAGCTGGG - Intronic
1162863769 19:13528129-13528151 ATCTCTACAAAAAGTTAGCTGGG - Intronic
1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG + Intronic
1163128717 19:15258755-15258777 GTCTGCACAAAAATTTAGCTGGG - Intronic
1163308540 19:16497944-16497966 GTTTCTACAAAAAGTTAGCTAGG + Intronic
1163866711 19:19779230-19779252 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1163873660 19:19847116-19847138 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1164403828 19:27924109-27924131 GTTTCTACAAAAAATTAGCTGGG - Intergenic
1164407222 19:27961294-27961316 GTCTCTACTAAAATTTAGCCGGG - Intergenic
1164928222 19:32148426-32148448 CTGTCTACAGTAATTTTTCTTGG - Intergenic
1165010178 19:32840331-32840353 GTCTCTACAAAAAGATAGCTGGG - Intronic
1165370111 19:35399972-35399994 GTCTCTACTAAAATTTAGCCAGG - Intergenic
1165391046 19:35539063-35539085 ATCTCTACAAAAAATTTGCCAGG - Intronic
1165735463 19:38172939-38172961 ATGTCTACAAAAAATTAGCTGGG + Intronic
1166040821 19:40201649-40201671 GTCTCTACAAAAAATTAGCCTGG - Intronic
1166192563 19:41184794-41184816 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1166666220 19:44682087-44682109 ATCTCTACAAAAATTTAGCTAGG + Intronic
1166667650 19:44690640-44690662 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1166717170 19:44976021-44976043 ATCTCTACAAAAAATTAGCTGGG - Intronic
1166765334 19:45249585-45249607 ATGGCTACAAAAAATTAGCTGGG + Intronic
1166809137 19:45505442-45505464 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1167023442 19:46896233-46896255 GTTTCTACAAAAAATTAGCCAGG + Intergenic
1167341773 19:48920847-48920869 GTCTCTACAGAAAATTGGCTGGG - Intronic
1167388379 19:49178160-49178182 ATGTCTATAAAAAATTAGCTGGG + Intronic
1168088330 19:54064628-54064650 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1168532688 19:57142308-57142330 GTCTCTACAAAAAATTAGCTGGG - Intronic
1168671615 19:58245106-58245128 ATCTCTACAAAAAATTAGCTGGG - Intronic
1168684984 19:58343563-58343585 GTGTCTACAAAAAATTAGCCGGG + Intergenic
925177303 2:1794586-1794608 GTGTCCCCAAGAATTTTGCTGGG - Intronic
925452536 2:3981961-3981983 CTTTCTTTAAAAATTTTGCTTGG - Intergenic
925796005 2:7543478-7543500 GTGTTTACAAATGTTTTGTTGGG - Intergenic
925989232 2:9240412-9240434 ATCTCTACAAAAAATTAGCTTGG - Intronic
926126403 2:10274864-10274886 GTCTCTACTAAAAATTAGCTAGG + Intergenic
926253876 2:11173156-11173178 CTCTCTACAAAAAATTGGCTGGG - Intronic
926678387 2:15645746-15645768 ATCTCTACAAAAAATTAGCTGGG + Intergenic
927164623 2:20305314-20305336 GTCTCTACAAAAAATTCACTGGG + Intronic
927164677 2:20306042-20306064 GTCTCTACAAAAAATTTGCCAGG + Intronic
927421154 2:22932033-22932055 ACCTCTAGAAAAATTTTGCTTGG + Intergenic
927650517 2:24910587-24910609 GTATCTAAAAACATTTTCCTCGG - Intronic
927703754 2:25284484-25284506 GTTTCTACTAAAAATTAGCTGGG + Intronic
927828164 2:26324088-26324110 ATCTCTACAAAAAGTTAGCTGGG + Intronic
927899266 2:26807407-26807429 GTCTCTACAAAAACTTAGTTGGG + Intergenic
927970150 2:27300705-27300727 GTCTCTACAAAAAATTAGCTGGG + Intronic
928690647 2:33794964-33794986 GTCTCTACAAAAACTTAGCTGGG + Intergenic
928706767 2:33957914-33957936 GTCTCTACTAAAAATTAGCTGGG - Intergenic
929102584 2:38330840-38330862 GTTTCTACAAGAAGTTAGCTGGG - Intronic
929473612 2:42221902-42221924 GTCTCTACAAAAAATTTATTAGG - Intronic
929645252 2:43619696-43619718 GTCTCTACAAAAAATTTGCTAGG - Intergenic
929697138 2:44127809-44127831 CTGTCTACAAAAAATTAGCCTGG + Intergenic
929870058 2:45751698-45751720 GTGTTTTGAAAAATGTTGCTTGG - Intronic
930060009 2:47280429-47280451 ATCTCTACAAAAAATTAGCTGGG - Intergenic
930557049 2:52910335-52910357 GTCTATTCAAATATTTTGCTCGG - Intergenic
930608288 2:53514717-53514739 ATCTCTACAAAAAATTAGCTGGG + Intergenic
930808430 2:55516514-55516536 GTCTCTACTAAAAATTAGCTTGG - Intergenic
930814197 2:55575604-55575626 GTCTCTACAAAAAATATACTGGG - Intronic
930971333 2:57398291-57398313 GTGTCTCCACAAATATTGCCTGG + Intergenic
931294416 2:60907473-60907495 ATCTCTACAAAAAATTGGCTGGG + Intronic
931345088 2:61439241-61439263 GTCTCTACAAAAAATTAGCCAGG + Intronic
931375428 2:61703467-61703489 ATCTCTACAAAAAATTAGCTGGG + Intergenic
931422695 2:62142904-62142926 GTCTCTACAAAAAATTAGCGAGG + Intronic
931430484 2:62205271-62205293 GTGGCGACAAAAACTTTTCTTGG + Intronic
931607036 2:64062903-64062925 ATCTCTACAAAAAATTAGCTAGG - Intergenic
932183637 2:69672623-69672645 GTATCCACAAAAATATTGTTTGG - Intronic
933693643 2:85198698-85198720 GTCTCTACAAAAAATTAGCTGGG + Intronic
933830638 2:86205068-86205090 GTCTCTACAAAAATTAGGCATGG + Intronic
933894865 2:86801510-86801532 ATCTCTACAAAAATTTAGCCAGG - Exonic
933995474 2:87665385-87665407 GTTTCTACAAAAAATTAGCCAGG + Intergenic
934073604 2:88408582-88408604 GTCTCTACAAAAAATTAGCCAGG - Intergenic
934687216 2:96330081-96330103 GTCTCTACAAAAAATTAGCTGGG + Exonic
934876463 2:97925038-97925060 GTCTCTACAAAAAATTAGCCAGG - Intronic
935080553 2:99789263-99789285 GTCTCTACAAAAAATTATCTGGG + Intronic
935164291 2:100556159-100556181 ATCTCTACAAAAAATTAGCTGGG + Intergenic
935797789 2:106662358-106662380 GTCTCTACTAAAAATTAGCTGGG - Intergenic
936298382 2:111285530-111285552 GTTTCTACAAAAAATTAGCCAGG - Intergenic
936408970 2:112236893-112236915 GTCTCTACAAAAACATAGCTGGG + Intronic
937122504 2:119450799-119450821 ATCTCTACAAAAAATTAGCTAGG + Intronic
937184914 2:120031035-120031057 GTCTCTACTAAAAATTAGCTGGG - Intronic
938209265 2:129452890-129452912 ATGTCTACAAAAACTTTTCTGGG - Intergenic
938269681 2:129958551-129958573 GTCTCTACAAAAAATTAGCCAGG - Intergenic
938339408 2:130525473-130525495 GTCTCTACAAAAAATTAGCCAGG + Intronic
938350430 2:130595279-130595301 GTCTCTACAAAAAATTAGCCAGG - Intronic
938576876 2:132612841-132612863 ATGTCTACAAAATATGTGCTAGG + Intronic
938845279 2:135202015-135202037 TTGTTTACAAAAAATGTGCTTGG + Intronic
939758464 2:146143783-146143805 ATGTCTACAAAAAATTTGACAGG - Intergenic
939944331 2:148390731-148390753 ATCTCTACAAAAATTTAGCTGGG - Intronic
940581916 2:155591236-155591258 GTCTCCACAAAAAGTTTACTTGG + Intergenic
941145381 2:161837558-161837580 GTATCTACAAAATTCCTGCTTGG - Intronic
941242376 2:163055194-163055216 GTCTCTACAAAAAATTTGGCCGG - Intergenic
941390486 2:164907432-164907454 GTCTCTACAAAAAATTAGCCGGG - Intronic
941812121 2:169765622-169765644 GTCTCTACAAAAAATTAGCCAGG - Intronic
941990472 2:171551115-171551137 ATCTCTACAAAAAATTAGCTGGG - Intronic
941998280 2:171622176-171622198 GTCTCTATAAAAAATTAGCTGGG + Intergenic
942006306 2:171703394-171703416 GTCTCTACAAAAAATCAGCTGGG - Intronic
942064236 2:172255101-172255123 GTTTCTACAAAAAATTAGCTGGG + Intergenic
942113854 2:172708131-172708153 GTCTCTACAAAAAATTAGCTGGG + Intergenic
942465366 2:176202372-176202394 ATCTCTACAAAAAATTAGCTGGG - Intergenic
942719279 2:178931995-178932017 GTCTCTACTAAAAATTAGCTGGG + Intronic
942771478 2:179526195-179526217 GTCTCTACAAAAAATTAGCTGGG - Intronic
943171717 2:184409198-184409220 GTATTTACAAAAATATTGGTAGG + Intergenic
943625849 2:190198470-190198492 GTCTCTACAAAAACTTAGGTAGG + Intronic
943749474 2:191496419-191496441 ATGTCTACTAAAAATTAGCTAGG + Intergenic
944007613 2:194929727-194929749 GCATGTACAAAAATTTTGATTGG - Intergenic
944181880 2:196904565-196904587 GTCTCTACTAAAAATTAGCTGGG + Intronic
944244614 2:197518428-197518450 GTTTCTGCAAAAAATTAGCTGGG - Intronic
944568438 2:201016447-201016469 GTCTCTATAAAAAATTAGCTGGG - Intronic
944618518 2:201487036-201487058 GTCTCTACAAAAAATCAGCTGGG - Intergenic
944703314 2:202264769-202264791 GTCTCTACAAAAAATTAGCTGGG + Intergenic
944777980 2:202988780-202988802 GTCTCTACAAAAAATTAGCCAGG - Intronic
944793159 2:203154073-203154095 GTCTCTACAAAAAATTAGCCGGG + Intronic
944796127 2:203187224-203187246 CTCTCTACAAAAAATTAGCTGGG - Intronic
944912731 2:204326412-204326434 GTCTCTACAACAAATTTGCCGGG - Intergenic
944951991 2:204762280-204762302 ATCTCTACAAAAAATTAGCTGGG - Intronic
945086127 2:206134463-206134485 GTCTCTACAAAAAATTGGCCAGG + Intronic
945108328 2:206338493-206338515 GTTTCTACAGAAAATTAGCTGGG + Intergenic
945226442 2:207535979-207536001 GTCTCTACAAAAAATTAGCCGGG - Intronic
945253483 2:207784264-207784286 GTCTCTACAAAAACTTAGCCAGG + Intergenic
946535419 2:220622419-220622441 GTTTCAACAAAAATTTTGGAGGG + Intergenic
946849133 2:223888240-223888262 CTTTGTACAAAAAATTTGCTGGG - Intronic
947159881 2:227202572-227202594 GTCTCTACAAAAAATTAGCCGGG + Intronic
947214447 2:227737157-227737179 ATCTCTACAAAAAATTAGCTAGG - Intergenic
947406556 2:229783728-229783750 GTGTCTACAAAAAGTTTGACAGG - Intronic
947950963 2:234146954-234146976 ATGTCTTTAAAAATTTTCCTAGG + Intergenic
948202279 2:236137870-236137892 GTCTCTACTAAAAATTAGCTGGG - Intergenic
949016461 2:241714762-241714784 GTCTCTACAAAAAATTAGCCAGG - Intronic
1168770807 20:415205-415227 GTCTCTACAAAACATTAGCTAGG + Intronic
1169362822 20:4965601-4965623 GTCTCTACAAAAAATTAGCCAGG + Intronic
1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG + Intergenic
1169699608 20:8431733-8431755 GTGTCAGCAAAAATTACGCTGGG + Intronic
1170068135 20:12337439-12337461 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1170115511 20:12854574-12854596 ATATCTACAAAATTTTTGCTTGG - Intergenic
1170158874 20:13292890-13292912 GTGTATAAAAAATTTTTGCAGGG - Intronic
1170448973 20:16462078-16462100 GTCTCTACTAAAAATTAGCTGGG + Intronic
1170546486 20:17439294-17439316 ATGTCTACAAAAAGTTAGCTGGG - Intronic
1170695410 20:18653231-18653253 GTCTCTATAAAAAATTAGCTGGG + Intronic
1171019547 20:21572944-21572966 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1171210628 20:23314159-23314181 GTCTCTAAAAAAAATTAGCTGGG - Intergenic
1171546414 20:26005414-26005436 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1171944064 20:31360319-31360341 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1171995619 20:31728649-31728671 ATTTCTACTAAAAATTTGCTGGG + Intergenic
1172172603 20:32949383-32949405 ATTTCTACAAAAATTCTTCTGGG - Intronic
1172244498 20:33436665-33436687 GTCTCTACAAAAAATTGGCTAGG + Intronic
1172341869 20:34164383-34164405 GTCTCTACAAAAAATTAGCTAGG - Intergenic
1172384173 20:34521875-34521897 ATCTCTACAAAAAATTAGCTGGG + Intronic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1172416543 20:34773542-34773564 GTGTCGAGCAAAATTTTCCTGGG - Intronic
1172442926 20:34978430-34978452 GTGTCCACAAAACTTGTGCTGGG + Intronic
1172457715 20:35091156-35091178 GTGTCTCCAAAAATTTAGCCGGG - Intronic
1172486478 20:35301092-35301114 GTCTCTACAAAAAGTTAGCTGGG - Intergenic
1172742025 20:37176475-37176497 ATCTCTACAAAAAATTAGCTGGG + Intronic
1172785112 20:37463634-37463656 GTTTCTACCAAAAGTCTGCTAGG + Intergenic
1172802039 20:37582491-37582513 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1173036204 20:39413519-39413541 GTGTCTACAAAAATGTGGAGGGG + Intergenic
1173396410 20:42684182-42684204 GTCTCTACTAAAAATTAGCTGGG + Intronic
1173608096 20:44346280-44346302 GTCTCTACAAAAAATTAGCGAGG - Intronic
1173843049 20:46171382-46171404 ATCTCTACAAAAAATTAGCTAGG + Intergenic
1174005690 20:47408938-47408960 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1174234979 20:49082310-49082332 GTCTCTACCAAAAAATTGCTGGG - Intronic
1174452146 20:50626851-50626873 GTCTCTACTAAAAATTAGCTGGG + Intronic
1174630215 20:51950386-51950408 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1176874368 21:14114015-14114037 GTCTCTACAAAAAATTAGCCAGG + Intronic
1177039547 21:16090715-16090737 TTGTTTACTAAAATTTTGTTTGG + Intergenic
1177578727 21:22992627-22992649 GCATCTTCAAAAATTTTGCCTGG + Intergenic
1177778500 21:25596396-25596418 GTGGCTTAAAAAATTTTACTCGG - Intronic
1178406008 21:32323802-32323824 GTCTCTACAAAAAATTAGCCAGG + Intronic
1178573010 21:33758281-33758303 GTTTCTACAAAAAATTAGCTGGG - Intronic
1178748642 21:35279172-35279194 GTGCCTACAGAAATCTTGCTGGG - Intronic
1178774053 21:35532187-35532209 GTCTCTACAAAAATTTAGCCGGG + Intronic
1179503932 21:41827508-41827530 GCTTCTACAAAAAATTAGCTGGG - Intronic
1179841880 21:44081716-44081738 GTCTCTACAAAAAATTAGCCAGG + Intronic
1179897792 21:44372333-44372355 GTCTCTACAAAAAATTAGCCGGG + Intronic
1180464074 22:15595115-15595137 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1180729964 22:17973758-17973780 GTCTCTACAAAAAATTAGCCAGG + Intronic
1180904440 22:19398806-19398828 ATCTCTACAAAAAATTGGCTGGG + Intronic
1180923011 22:19531747-19531769 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1180925629 22:19552491-19552513 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1181347749 22:22232440-22232462 GTCTCCACAAAAAGTTAGCTGGG + Intergenic
1181364909 22:22368790-22368812 GTGTCCAGAAAAATTTTGATTGG + Intergenic
1181588687 22:23869179-23869201 ATCTCTACAAAAAATTAGCTAGG + Intronic
1181970782 22:26688261-26688283 GTCTCTACAAAAAATTAGCCGGG + Intergenic
1182274765 22:29180518-29180540 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1182283125 22:29229171-29229193 ATCTCTACAAAAAATTAGCTAGG + Intronic
1182329409 22:29540109-29540131 GTCTCTACTAAAAATTAGCTGGG + Intronic
1182365220 22:29774269-29774291 GTCTCTGCAAAAAATTAGCTGGG - Intergenic
1182384187 22:29922185-29922207 GTCTCTACTAAAAATTAGCTGGG - Intronic
1182524135 22:30905310-30905332 GTTTCTACTAAAAATTAGCTGGG - Intronic
1182536103 22:31004203-31004225 GTCTCTGCAAAAAATTAGCTGGG + Intergenic
1183190824 22:36321111-36321133 GTCTCTACTAAAAATTAGCTGGG - Intronic
1183578007 22:38704464-38704486 GTCTCTACCAAAAATTAGCTGGG - Intergenic
1183737543 22:39652162-39652184 GTCTCTACTAAAAATTAGCTGGG - Intronic
1183894514 22:40957475-40957497 GTCTCTACAAAAAATTAGCCAGG + Intronic
1184423224 22:44393847-44393869 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1184623181 22:45699075-45699097 GTGTTTACATAAAATTTGATGGG - Intronic
1184941785 22:47773112-47773134 TTGTCTAAAAAAATCATGCTGGG - Intergenic
949140885 3:631513-631535 GTGTATATAAAAATTTTGAGTGG + Intergenic
949584137 3:5421381-5421403 GTTTCTACTAAAAATTAGCTGGG + Intergenic
950028456 3:9836136-9836158 GTTTCTACAGAAAATTAGCTGGG + Intronic
950240829 3:11368621-11368643 GTCTCTACAAAAAATTAGCCAGG + Intronic
950288486 3:11764162-11764184 GTCTCTACAAAAAATTAGCCGGG - Intergenic
951250090 3:20384226-20384248 ATGTTTACAAAAAATTAGCTGGG + Intergenic
951793341 3:26510802-26510824 ATTACTACAAGAATTTTGCTGGG - Intergenic
952065426 3:29563854-29563876 GTCTCTACAAAAAATTAGCCAGG + Intronic
952272881 3:31849867-31849889 TTCTCTACAAAAATTTAGCCAGG + Intronic
952275484 3:31871700-31871722 GTTTCTACAAAAAATTAGCCGGG + Intronic
952324761 3:32311276-32311298 GTGTCTACAAATAGTTTTATTGG + Intronic
952509309 3:34037687-34037709 TTCTCTACAAAAAATTAGCTGGG - Intergenic
952529733 3:34251132-34251154 GTCTCTACAAAAAATTAGCCAGG - Intergenic
952779974 3:37087020-37087042 GTCTCTACAAAAAATTAGCCAGG - Intronic
952788511 3:37178623-37178645 GTCTCTACAGAAAATTAGCTGGG + Intronic
953168932 3:40489936-40489958 GTTTCAACAAGAATTTTGCTGGG - Exonic
953223315 3:40994067-40994089 ATGTCTACAAAAAGCCTGCTGGG + Intergenic
953306817 3:41839177-41839199 GTCTCTACTAAAAATTAGCTGGG + Intronic
953514855 3:43579982-43580004 GTCTTTACAAAAAATTAGCTGGG + Intronic
953594593 3:44298293-44298315 ATCTCTACAAAAAATTAGCTGGG + Intronic
953672935 3:44977665-44977687 GTGTATACAAAAATATAGCAGGG - Intronic
953701940 3:45203285-45203307 ATCTCTACAAAAATTTTTTTAGG + Intergenic
954090567 3:48280471-48280493 GTCTCTACTAAAAATTAGCTGGG + Intronic
954204184 3:49045758-49045780 ATCTCTACAAAAAATTAGCTGGG - Intronic
954318749 3:49816286-49816308 ATCTCTACAAAAAATTAGCTAGG - Intergenic
954372999 3:50178990-50179012 GTCTCTACTAAAAATTAGCTGGG - Intronic
954598563 3:51850033-51850055 GTGTTTACAAACCTTTAGCTAGG - Intergenic
954607557 3:51925031-51925053 GTCTCTTCTAAAATTCTGCTGGG - Intergenic
954937868 3:54343450-54343472 ATCTCTACAAAAAATTAGCTGGG - Intronic
955294102 3:57719629-57719651 ATCTCTACAAAAAATTTGCCAGG + Intergenic
955334101 3:58070818-58070840 GTCTCTTCTAAAAATTTGCTGGG - Intronic
955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG + Intronic
955722439 3:61897606-61897628 ATGTCTGCAAAAACTTTCCTGGG + Intronic
955852551 3:63236400-63236422 GTATCTACAAAAACCTTGCTGGG + Intronic
956096383 3:65720908-65720930 GTCTCTACAAAAAATTAGCCAGG - Intronic
956445849 3:69324924-69324946 GTCTCTACAAAAAATTAGCCAGG + Intronic
956844566 3:73170431-73170453 GTTTCTACAAAAAATTAGCCAGG - Intergenic
957001179 3:74886816-74886838 ATGTGTACAAAAACCTTGCTGGG + Intergenic
957015731 3:75062713-75062735 GTTTCAACAAGAATTTTGCTAGG - Intergenic
957229235 3:77490258-77490280 GTCTCTACTAAAAATTAGCTGGG - Intronic
957790338 3:84932574-84932596 TAGTCTTCACAAATTTTGCTGGG - Intergenic
957858607 3:85913252-85913274 TTGTCTACTAAAACCTTGCTAGG - Intronic
958984723 3:100767106-100767128 GTCTCTACAAAAAATTAGCTGGG - Intronic
959072107 3:101712237-101712259 GTCTCTACAAAAAATTAGCCGGG + Intergenic
959817298 3:110689702-110689724 GTCTCTACAAACATTTTAATTGG + Intergenic
960293158 3:115911510-115911532 GTCTCTACAAAAAATTAGCCAGG - Intronic
960491246 3:118318861-118318883 CTGTCTTCAAAAATGGTGCTGGG + Intergenic
960670657 3:120152711-120152733 GTATCTACAAAAAATTAGCTGGG - Intergenic
960741414 3:120837932-120837954 GTTTCTACTAAAAATTAGCTGGG - Intergenic
961132861 3:124484933-124484955 GTCTCTACAAAAAATTAGCTGGG + Intronic
961161584 3:124731059-124731081 GTCTCTACAAAAAATTAGCTGGG + Intronic
961726042 3:128931334-128931356 GTCTCTACAGAAAATTAGCTGGG - Intronic
961746169 3:129064758-129064780 GTCTCTACCAAAAATTAGCTGGG - Intergenic
961831304 3:129624293-129624315 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
961861970 3:129924524-129924546 GTCTCTATAAAAAATTAGCTGGG - Intergenic
961866865 3:129959759-129959781 GTCTCTACAAAAAATTAGCTGGG - Intergenic
961915787 3:130373170-130373192 GTGACTACATAAATTTTGCGAGG + Intronic
962393768 3:134996352-134996374 ATCTCTACAAAAAATTGGCTGGG - Intronic
963014728 3:140811363-140811385 GCCTCTACAAAAAATTAGCTGGG + Intergenic
963153177 3:142068725-142068747 GTCTCTACGAAAAATTAGCTGGG - Intronic
964219978 3:154331979-154332001 GTCTCTACCAAAAATTAGCTGGG + Intergenic
964341761 3:155715771-155715793 GTTTCCACAAAAAATTAGCTGGG - Intronic
964488418 3:157209275-157209297 GTCTCTACAAAAAATTAGCCAGG - Intergenic
964797597 3:160516609-160516631 GTCTCTACAAAATATTAGCTGGG + Intronic
965187228 3:165480878-165480900 GTCTTTTCAACAATTTTGCTTGG + Intergenic
965257796 3:166438709-166438731 ATGTCTACAAATATTTATCTAGG - Intergenic
965308999 3:167105061-167105083 GTATTTACAAAAATTTTGGTAGG - Intergenic
965552874 3:169987256-169987278 GTTTCTACAAAAAATTAGCCGGG + Intronic
965897790 3:173598774-173598796 TTGTCTACAAGAAGTTTCCTGGG + Intronic
966107599 3:176355913-176355935 GTGTGTACACAAATTTTTATAGG - Intergenic
966392963 3:179472530-179472552 GTCTCTACAAAAAACTTGCCAGG - Intergenic
966795419 3:183708859-183708881 GTCTCTAAAAAAATTTTTTTTGG + Intronic
968082495 3:195856377-195856399 GTCTCTACAAAAAATTAGCCGGG + Intergenic
968143929 3:196281856-196281878 ATCTCTACAAAAAATTAGCTGGG - Intronic
968528265 4:1075829-1075851 ATCTCTACAAAAAATTAGCTGGG - Intronic
968543714 4:1184135-1184157 GTCTCTACGAAAAATTAGCTGGG - Intronic
968711255 4:2120273-2120295 ATGTCTACAAAAACCTTGTTTGG + Intronic
969286801 4:6207611-6207633 GTCTCTACAAAAAATTAGCCAGG - Intergenic
969815726 4:9685982-9686004 GTCTCTACAAAAAATTAGCTGGG + Intergenic
970149618 4:13075384-13075406 GTCTCTACAAAAAATTAGCTGGG - Intergenic
970595618 4:17597435-17597457 GTGTCTACAAAAAGCTAGCCAGG - Intronic
971308323 4:25502986-25503008 ATCTCTACAAAAAATTAGCTAGG + Intergenic
971397346 4:26241034-26241056 GTTTCTACAAAAAATTAGCCAGG + Intronic
972352421 4:38248472-38248494 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
972486795 4:39549440-39549462 GTGCCTACAAAAAATTAGCCGGG - Exonic
972553576 4:40158627-40158649 GTCTCTACAAAAAATTAGCCAGG + Intergenic
972974332 4:44615130-44615152 GTGTTGACAAAAATAATGCTAGG + Intergenic
973534148 4:51864392-51864414 GTGTTTAAATAATTTTTGCTAGG - Intronic
973622539 4:52741961-52741983 GTCTCTACAAAAAATTAGCCAGG - Intronic
973793719 4:54402325-54402347 GTCTCTACAAAAAATTAGCCGGG + Intergenic
973979435 4:56295331-56295353 GTGTCCAATAAAATTTAGCTAGG + Intronic
974071016 4:57123716-57123738 GTCTCTACAAAAAATTAGCTGGG - Intergenic
974555491 4:63441674-63441696 TTGTATTCAAAAATTTTCCTTGG + Intergenic
976420180 4:84833506-84833528 ATCTCTACAAAAAATTAGCTAGG + Intronic
976586038 4:86798298-86798320 GTGACAACACTAATTTTGCTGGG - Intronic
977355111 4:95936239-95936261 GTATCTACAAAATAGTTGCTGGG - Intergenic
977586100 4:98777234-98777256 ATCTCTACAAAAAATTAGCTGGG + Intergenic
978029475 4:103921891-103921913 ATCTCTACAAAAAATTAGCTGGG + Intergenic
978613035 4:110565621-110565643 GTCTCTACAAAAAATTAGCCTGG - Intergenic
978983960 4:114985564-114985586 GAGGCTACATAAATTATGCTAGG + Intronic
979130229 4:117035549-117035571 GGCTCTACAAACATTTTCCTTGG + Intergenic
979456766 4:120934664-120934686 GTCTCTACAAAAAATTAGCCAGG + Intergenic
979666254 4:123314137-123314159 GTGTTAAAAAAAATTTTACTAGG + Exonic
980114065 4:128662609-128662631 GTCTCTACAAAAAATTAGCCAGG - Intergenic
980248829 4:130286070-130286092 GTGCCTACAAAAATTTAGGCTGG - Intergenic
980635920 4:135502908-135502930 GTGTCTAATAATATTTTGCTGGG - Intergenic
980732618 4:136842663-136842685 GTATCTACTAAAAATTAGCTGGG - Intergenic
981166501 4:141565195-141565217 GTCTCTACCAAAAATTAGCTGGG + Intergenic
981224803 4:142281402-142281424 GTGTCTAAAAGCATTTTGATTGG - Intronic
981756270 4:148144363-148144385 GTCTCTACAAATAATTAGCTAGG - Intronic
981977526 4:150748730-150748752 GTTTCTACAAGAATTTTGGAGGG - Intronic
982053202 4:151524139-151524161 GTCTCTACAAAAAATTAGCTGGG + Intronic
982185867 4:152798087-152798109 GTCTCTACAAAAAATTAGCTGGG + Intronic
982457900 4:155631923-155631945 GTCTCTACTAAAAATTAGCTGGG - Intergenic
983094005 4:163540851-163540873 GTCCCTACAAAAAATTAGCTGGG + Intronic
983176470 4:164594402-164594424 GTGTATACTAACATTTTTCTAGG + Intergenic
983246175 4:165290301-165290323 ATCTCTACAAAAAATTAGCTGGG - Intronic
983443347 4:167816010-167816032 GTCTCTACAAAAAATTAGCTGGG + Intergenic
983494882 4:168431391-168431413 GTGTCTACGAAGATTCTGCATGG - Intronic
983559426 4:169086123-169086145 GTCTCTACAAAAAGTTACCTGGG + Intergenic
984020430 4:174478462-174478484 GTCTCTACTAAAAATTAGCTGGG + Intergenic
984313964 4:178102364-178102386 ATCTCTACAAAAAATTAGCTGGG + Intergenic
984358475 4:178696375-178696397 ATCTCTACAAAAAATTAGCTGGG + Intergenic
984385783 4:179055891-179055913 GTGTCAACATGAATTTTGCAGGG - Intergenic
984815406 4:183831551-183831573 TGGTCTAGAAATATTTTGCTAGG + Intergenic
984973830 4:185212547-185212569 GTCTCTACAAAAACTTAGCCAGG - Intronic
985120821 4:186639971-186639993 GTATCTACAAAAAGTTAGCCAGG + Intronic
986049532 5:4076116-4076138 ATCTCTACAAAAAATTAGCTGGG + Intergenic
986104400 5:4645913-4645935 GTCTCTCCAAAAAATTAGCTGGG - Intergenic
986737347 5:10677901-10677923 TTTTCTGCAAAAACTTTGCTGGG - Intergenic
986763007 5:10897144-10897166 GTCTCTACCAAAAATTAGCTGGG + Intergenic
986765771 5:10924625-10924647 GTGTGTGCGAACATTTTGCTGGG + Intergenic
986822320 5:11481440-11481462 GTCTCTACAAAAAATTAGCCGGG + Intronic
987010497 5:13758332-13758354 GTCTCTACAAAAAATTAGCCAGG + Intronic
988448320 5:31312528-31312550 GTCTCTACAAAAAATTAGCAGGG + Intronic
988538141 5:32087193-32087215 GTGTCTACAGAGGTCTTGCTGGG - Exonic
988570369 5:32359024-32359046 GTCTCTACAAATAATTAGCTGGG + Intronic
989082679 5:37641274-37641296 CTGTCTACTAAAAATTAGCTGGG - Intronic
990087775 5:51999954-51999976 GTCTCTACAAAAAATTAGCCGGG + Intergenic
990438308 5:55817626-55817648 GTCTCTACTAAAAATTAGCTGGG - Intergenic
990562705 5:56999122-56999144 ATATTTACAAAAATCTTGCTGGG - Intergenic
991057708 5:62337662-62337684 GTCTCTACAAAAAATTTGCCAGG + Intronic
991063301 5:62400917-62400939 ATCTCTACAAAAAATTGGCTGGG - Intronic
991332582 5:65508256-65508278 GTGTCTACAAAATTATTACTAGG + Intergenic
991684684 5:69170784-69170806 ATCTCTACAAAAAATTAGCTGGG - Intronic
992103355 5:73428768-73428790 ATCTCTACAAAAAATTAGCTAGG - Intergenic
992385144 5:76277603-76277625 GTCTCTACAAAAAGTTAGCCGGG + Intronic
992517337 5:77508279-77508301 GTCGCTACAAAAAATTAGCTGGG - Intronic
992530548 5:77647820-77647842 GTGTGAAAAAAAATTCTGCTGGG - Intergenic
992799483 5:80282602-80282624 CTCTCTACAAAAAATTAGCTGGG + Intergenic
992805614 5:80334527-80334549 ATCTCTACAAAAAATTAGCTGGG + Intergenic
992858528 5:80889164-80889186 GTTTCTACAAAAAATTAGCTGGG + Intergenic
993062906 5:83061561-83061583 GTCTCTACTAAAAGTTAGCTGGG - Intronic
993557539 5:89359783-89359805 GTATCTACAAAACTTCTGCTGGG - Intergenic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
993807289 5:92426770-92426792 GTCTCTACAAAAAATTAGCTGGG - Intergenic
994086715 5:95767048-95767070 GTCTCTACAAAAAATCAGCTGGG + Intronic
994177279 5:96724660-96724682 GTGTCTACAAAAAATTAGCCAGG + Intronic
994210042 5:97077439-97077461 GTCTCTACAAAAAGTTAGCCAGG + Intergenic
994561301 5:101376676-101376698 GTGTCATCAAAATTTTTGCTGGG + Intergenic
994621494 5:102168532-102168554 ATCTCTACAAAAAATTAGCTGGG + Intergenic
994925283 5:106109843-106109865 GTGTTTACAAAATATTTGCTAGG + Intergenic
995093143 5:108204349-108204371 ATCTCTACAAAAAATTAGCTGGG - Intronic
995103243 5:108342382-108342404 GTGTATTTAAAAATTTTTCTAGG - Intronic
995504768 5:112848752-112848774 GTCTCTACAAAAAATTAGCTGGG + Intronic
995873888 5:116770167-116770189 ATCTCTACAAAAAATTAGCTGGG + Intergenic
996153163 5:120064727-120064749 GTCTCTACTAAAAATTAGCTGGG - Intergenic
996314063 5:122141606-122141628 ATCTCTACAAAAAATTAGCTAGG - Intronic
996375952 5:122807115-122807137 GTCTCTACAAAAAATTAGCTGGG + Intronic
996812382 5:127531781-127531803 GTCTCTACCAAAAATTAGCTGGG - Intronic
996922844 5:128789020-128789042 GTGTATACAAAATTATTGTTGGG + Intronic
997024272 5:130039644-130039666 GTCTCTACAAAAAATTAGCCTGG - Intronic
997059535 5:130484725-130484747 GTGTCTACTGAAAATTTGCTAGG - Intergenic
997144795 5:131421218-131421240 ATCTCTACAAAAAATTAGCTGGG - Intergenic
997262018 5:132472565-132472587 GTCTCTACAAAAAATTAGCTGGG + Intronic
997703821 5:135928772-135928794 ATATCTACAAAAATATTGCTGGG - Intronic
997994132 5:138572115-138572137 GTCTCTACAAAAAATTAGCCGGG - Intronic
998459989 5:142302766-142302788 GTCTCTACTAAAAATTAGCTGGG + Intergenic
998854684 5:146382932-146382954 GTCTCTACTAAAAATTAGCTGGG + Intergenic
998953466 5:147414722-147414744 GTGTCACCAAAGATTTTGCAGGG + Intronic
999464366 5:151788082-151788104 GTCTCTACAAAAAATTAGCTGGG - Intronic
999785954 5:154890922-154890944 GTCTCTACTAAAAATTAGCTGGG - Intronic
999832526 5:155334257-155334279 GTTGCTACAAAAAATTAGCTGGG + Intergenic
999870185 5:155741851-155741873 GTCTCTACCAAAAATTAGCTGGG - Intergenic
999900739 5:156084120-156084142 GTGTCTACAAAAATTTTGCTTGG + Intronic
999985104 5:156996030-156996052 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1000055968 5:157606477-157606499 GTGTCTATAAAAAATTGACTGGG + Intergenic
1000094926 5:157963251-157963273 ATCTCTACAAAAAATGTGCTGGG - Intergenic
1000187182 5:158870513-158870535 ATCTCTACAAAAAATTAGCTGGG + Intronic
1001079628 5:168657843-168657865 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1001117212 5:168949758-168949780 ATTTCTACAAAAAATTAGCTGGG - Intronic
1001359803 5:171071322-171071344 ATATCTACAAAAAATATGCTGGG - Intronic
1001877339 5:175213011-175213033 ATGTCTACAAAAAATTAGCTGGG - Intergenic
1001915807 5:175558950-175558972 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1001972235 5:175966020-175966042 GTCTCTACAAAAAATTAGCCAGG + Intronic
1002138891 5:177126563-177126585 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1002146663 5:177188790-177188812 CTGTTTAAAAAAATTATGCTAGG - Intronic
1002166941 5:177353688-177353710 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1002245205 5:177877757-177877779 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1002291277 5:178202684-178202706 GTGTTTACAAAAAATTCGCTTGG + Intergenic
1003204545 6:3995069-3995091 GCCTCTACAAAAAATTAGCTGGG + Intergenic
1003211368 6:4070833-4070855 TTGTCTACAAAAAATTAGCTGGG + Intronic
1003354158 6:5350307-5350329 GTGTATAAAAAAATCTTGCTGGG - Intronic
1003662721 6:8077943-8077965 GTCTCTACAAAAATTAGGCATGG - Intronic
1003859422 6:10308545-10308567 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1003944164 6:11058356-11058378 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1004173902 6:13322078-13322100 GTCTCTACAAAAAATTAGCCAGG + Intronic
1004986694 6:21090963-21090985 GTCTCTACAAAAAATTAGCTAGG - Intronic
1005299593 6:24457710-24457732 GTCTCTACTAAAAATTAGCTGGG + Intronic
1005352986 6:24954614-24954636 GTCTCTACAAAAAATTTGCCAGG - Intronic
1005690208 6:28297519-28297541 GTGTCTACAAAAAATTACCTGGG - Intronic
1005993111 6:30915571-30915593 GTGTCTCCAAAGATTTCTCTTGG + Intronic
1006059168 6:31406786-31406808 GTCTCTTCAAAAATGGTGCTGGG - Intronic
1006095613 6:31654518-31654540 GTGTCTACAAAAAATTAGCTAGG + Intronic
1006330227 6:33385091-33385113 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1006391118 6:33759400-33759422 GTGTATACAAAAAATTAGCCAGG - Intergenic
1007184396 6:39955928-39955950 GTTTCTACAAAAACCTTTCTAGG - Intergenic
1007515659 6:42409116-42409138 GTCTCTACAAAAAATTAGCTGGG + Intronic
1007602632 6:43092332-43092354 ATCCCTACAAAAATTTAGCTGGG - Intronic
1007654226 6:43442567-43442589 GTCTCCAAAAAAATTTAGCTGGG + Intronic
1007676268 6:43598042-43598064 GTCTCTACAAAAAATTAGCCAGG + Intronic
1007779520 6:44244896-44244918 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1008411352 6:51183559-51183581 ATTTCTGCATAAATTTTGCTGGG + Intergenic
1008658418 6:53640654-53640676 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1008699169 6:54078421-54078443 GTCTCTACAAAAAATTAGCCAGG + Intronic
1009004389 6:57764997-57765019 GTCTCTACAAAAAATTAGCGGGG + Intergenic
1009417586 6:63432734-63432756 TTTTCTAGAAAAATTTTACTGGG + Intergenic
1009473478 6:64057990-64058012 GTCTCTACGAAAAATTAGCTGGG - Intronic
1009690955 6:67031347-67031369 GTGTTTACAAAGCTTTAGCTAGG - Intergenic
1009919410 6:70038894-70038916 GTCTCTACTAAAAATTAGCTGGG + Intronic
1009989679 6:70826593-70826615 ATCTCTACAAAAAATTAGCTGGG + Intronic
1010193146 6:73213889-73213911 GTGTCAAAAAAAATTTTTTTTGG + Intronic
1010326067 6:74563177-74563199 ATGACTACAACAATTTTGATAGG + Intergenic
1010687911 6:78873637-78873659 GTCTCTATAAAAAATTAGCTGGG - Intronic
1010692761 6:78930094-78930116 GTCTCTACAAAAAATTAGCTGGG - Intronic
1011040671 6:83026850-83026872 GTCTCTACAAAAAATTAACTGGG - Intronic
1011556840 6:88578732-88578754 ATATCTACAAAAATCCTGCTGGG + Intergenic
1011609061 6:89132675-89132697 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1011680897 6:89782425-89782447 GTCTCTACAAAACATTTGCTGGG + Intronic
1011726436 6:90214921-90214943 GTCTCTACAAAAAATTATCTGGG - Intronic
1011945381 6:92894583-92894605 GTTTCTGCAACACTTTTGCTAGG + Intergenic
1012440475 6:99257588-99257610 GTGTCTACAAAAATTTAGCCAGG - Intergenic
1012453319 6:99376800-99376822 GTCTCTACTAAAAATTAGCTGGG + Intronic
1012455972 6:99405723-99405745 GTCTCTACAAAAAATTAGCCGGG - Intronic
1012894878 6:104936984-104937006 CTCTCTACAAAAAATTCGCTGGG - Intergenic
1012927302 6:105280729-105280751 GTCTCTACAAATAATTAGCTGGG - Intronic
1013471165 6:110467645-110467667 GTGTATCCAAAAATTTAGCCTGG + Intronic
1013532020 6:111029038-111029060 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1014228126 6:118871744-118871766 GTCTCTACAAAAAATTAGCCAGG + Intronic
1014501219 6:122192173-122192195 GTTTCTTGAAAAATTTTGGTAGG + Intergenic
1014541160 6:122678066-122678088 GTCTCTACAAAAAATTAGCCGGG - Intronic
1014679779 6:124413574-124413596 GTGTCTCAAAATATCTTGCTGGG + Intronic
1014940426 6:127431827-127431849 GTGATTACACAAATTTTGCATGG + Intergenic
1014987608 6:128030926-128030948 GTGTCTAATAAATATTTGCTGGG - Intronic
1015115818 6:129648330-129648352 GTCTCTACAAAAAGTTAGCCAGG - Intronic
1015598630 6:134890952-134890974 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1016324876 6:142889300-142889322 GTCTCTACAAAATATTAGCTGGG + Intronic
1016339367 6:143045126-143045148 GTGTCTACTGAAAATTAGCTGGG - Intergenic
1016504319 6:144761484-144761506 ATCTCTACAAAAAATTAGCTGGG + Intronic
1016637826 6:146315179-146315201 GTCTCTCCAAAAAGTTAGCTGGG + Intronic
1016995739 6:149961462-149961484 GTGTCCACAAAGATTTTCCAAGG - Intergenic
1017002885 6:150008007-150008029 GTGTCCACAAAGATTTTCCAAGG + Intergenic
1017012450 6:150071705-150071727 GTGTCCACAAAGATTTTCCAAGG + Intergenic
1017145477 6:151230581-151230603 GTGACTACAAAAAATTAGCTGGG + Intergenic
1017157270 6:151333580-151333602 GTTTCTACTAAAAATTAGCTGGG + Intronic
1017179206 6:151534223-151534245 ATCTCTACAAAAAATTAGCTGGG - Intronic
1017831358 6:158133136-158133158 ATCTCTACAAAAAATTAGCTGGG + Intronic
1018210320 6:161475063-161475085 GTCTCTACTAAAAATTAGCTGGG - Intronic
1018609581 6:165634831-165634853 GTGTCTACAGAAAGTTTGTTAGG - Intronic
1018627758 6:165796254-165796276 ATCTCTACAAAAAATTAGCTGGG - Intronic
1019006148 6:168798440-168798462 GTGTCAACATAAATTTTGGGGGG - Intergenic
1019070802 6:169343174-169343196 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1019091981 6:169545023-169545045 GTGTCTACAAAAATTCTTTTTGG - Intronic
1019495736 7:1339701-1339723 GAGTCTCCAAAAATTTTCCAAGG - Intergenic
1019556975 7:1636933-1636955 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1019663175 7:2237165-2237187 GTCTCTACAAAAAATTAGCCAGG - Intronic
1019692005 7:2420636-2420658 ATCTCTACAAAAAATTAGCTGGG + Intronic
1019726232 7:2604277-2604299 GTCTCTACAGAAAATTAGCTGGG - Intronic
1019960068 7:4451602-4451624 GTTTCTACAAAAAATTAGTTGGG + Intergenic
1019966318 7:4501591-4501613 TTTTCTACAAAAACCTTGCTGGG - Intergenic
1020061940 7:5159247-5159269 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1020126856 7:5537860-5537882 GTCTCTACAAAACATTAGCTGGG - Intronic
1020166207 7:5809433-5809455 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1020170543 7:5841382-5841404 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1020187118 7:5967847-5967869 GTCTCTACAAAAAATTAGCCAGG - Intronic
1020207751 7:6132091-6132113 GTCTCTACAAAAAATTAGCCAGG - Intronic
1020266449 7:6563519-6563541 ATCTCTACAAAAAATTAGCTAGG + Intergenic
1020295799 7:6756925-6756947 GTCTCTACAAAAAATTAGCCAGG + Intronic
1020595301 7:10200299-10200321 ATATCTACAAAATTCTTGCTTGG + Intergenic
1021095825 7:16535026-16535048 GTCTCTACAAAAAATTAGCTAGG + Intronic
1021266875 7:18535677-18535699 GAATCTACAAACATTTTTCTGGG + Intronic
1021547136 7:21826638-21826660 GGGTTTACAAACATTTTCCTTGG + Intronic
1021982481 7:26068341-26068363 GTCTCTACAAAAAATTGGTTAGG + Intergenic
1022209476 7:28194758-28194780 ATGTTTACAAAAAATTAGCTGGG - Intergenic
1022361845 7:29667649-29667671 ATATCTACAAAAATCTTGTTGGG + Intergenic
1022602183 7:31771883-31771905 GTCTCTACAAAAAATTAGCTGGG + Intronic
1022699546 7:32746084-32746106 ATATCTACAAAAATCTTGTTGGG - Intergenic
1022710983 7:32849945-32849967 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1022728472 7:33001372-33001394 GTCTCTACAAAAAATTAGCTGGG + Intronic
1022729981 7:33013289-33013311 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1023235209 7:38078897-38078919 TTCTCTACAAAAAATTAGCTGGG - Intergenic
1023816163 7:43951689-43951711 GTCTCTACAAAAAATTAGCCAGG - Intronic
1023904140 7:44509620-44509642 GTTTCCACAAAAAATTTTCTGGG + Intergenic
1024302250 7:47896166-47896188 GTCTCTACAAAAAATTAGCCAGG + Intronic
1024728080 7:52222943-52222965 GTGTCTATAAAATTCTTACTAGG - Intergenic
1024867955 7:53925524-53925546 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1025191976 7:56902684-56902706 GTGTCCATAAAAATATAGCTTGG + Intergenic
1025679976 7:63674247-63674269 GTGTCCATAAAAATATAGCTTGG - Intergenic
1025937534 7:66049218-66049240 GTCTCTACCAAAAATTAGCTGGG - Intergenic
1025937834 7:66051267-66051289 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1025999968 7:66552938-66552960 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1026253850 7:68693754-68693776 GTTTCAACATAAATTTTGCAGGG + Intergenic
1026386260 7:69851365-69851387 GTATTTACAAAAATTTTGCAGGG + Intronic
1026498886 7:70926046-70926068 GTCTCTACAACAATTTAGCTGGG + Intergenic
1026989825 7:74578344-74578366 GTCTCTACAAAAAATTAGCTGGG - Intronic
1026993148 7:74599124-74599146 GTCTCTACAAAAAATTAGCCAGG + Intronic
1027253773 7:76416636-76416658 GTCTCTACAAAAAAATAGCTGGG + Intronic
1027372678 7:77522810-77522832 ATATCTACAAAAAATTAGCTGGG - Intergenic
1027779623 7:82505826-82505848 ATCTCTACAAAAATTTAGCTAGG - Intergenic
1028104316 7:86859124-86859146 ATCTCTAAAAAAATTTAGCTGGG - Intronic
1028545385 7:91993347-91993369 GTCTCTACAAAAAATTAGCTGGG - Intronic
1029251592 7:99240680-99240702 GTTTCTACAAAAAATTAGCCAGG + Intergenic
1029257273 7:99278109-99278131 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1029336791 7:99907276-99907298 GTCTCTACTAAAAATTAGCTGGG - Intronic
1029464082 7:100714655-100714677 GTCTCTACAGAAAATTTGTTAGG - Intergenic
1029466653 7:100729702-100729724 GTTTCTATAAAAAATTTGCTGGG + Intergenic
1029568029 7:101351947-101351969 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1029657743 7:101938271-101938293 GTCTCTGCAAAAAATTAGCTGGG - Intronic
1029936011 7:104424819-104424841 GTCTCTACAAAAAATTAGCCGGG + Intronic
1030006925 7:105129120-105129142 GTCTCTACAAAAAATTAGCCGGG - Intronic
1030171146 7:106604047-106604069 ATGTCTACAAAAAATTAGTTGGG + Intergenic
1030871074 7:114757272-114757294 GTTTCTACAAAAAGTTAGCCAGG - Intergenic
1031501507 7:122523740-122523762 GTGTAGACAAAAATTTTGAAGGG - Intronic
1032097148 7:128945271-128945293 GTCTTTACAAAAAATTAGCTGGG - Intronic
1032277232 7:130468995-130469017 ATGTCTACAAAAAAGTTGGTGGG + Intergenic
1032412464 7:131706998-131707020 GTCTCTACAAAAACTTAGCTGGG - Intergenic
1032719630 7:134540055-134540077 GTCTCTACCAAAAATTAGCTGGG + Intronic
1032847623 7:135765368-135765390 GTCTCTACAAAAATAATGCCAGG - Intergenic
1033214949 7:139486624-139486646 CTGTCTGCCAAAATTTTCCTTGG + Intergenic
1033381191 7:140821150-140821172 GTCTCTACAAAAAATTAGCCAGG - Intronic
1033735722 7:144219636-144219658 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1033747329 7:144331317-144331339 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1034512198 7:151545094-151545116 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1035001225 7:155613644-155613666 GTCTCTACAAAAAATTAGTTGGG + Intronic
1035690535 8:1556817-1556839 GTCCCTACAACAATTTAGCTTGG - Intronic
1035870894 8:3135082-3135104 GTCTCTACAAAAAATTAGCTGGG - Intronic
1036422099 8:8606652-8606674 GTGTCAACAAAAACCATGCTTGG + Intergenic
1036717140 8:11136341-11136363 GTCTCTACTAAAAATTAGCTGGG + Intronic
1037358034 8:18043386-18043408 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1037944344 8:22977409-22977431 GTCTCTACAAAACATTAGCTGGG + Intronic
1037945374 8:22986425-22986447 GTCTCTACAAAAAATTAGCCAGG - Intronic
1037976262 8:23215345-23215367 GTCTCTACTAAAAATATGCTGGG + Intronic
1038183713 8:25252990-25253012 GTCTCTACTAAAAATTAGCTGGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038768890 8:30457744-30457766 GTCTCTACTAAAAATTAGCTGGG - Intronic
1039241822 8:35565652-35565674 ATGTCTACAATAATTTTTCTAGG + Intronic
1039624772 8:39037584-39037606 GTCTCTACAAAAAATAAGCTGGG - Intronic
1039764144 8:40610269-40610291 GTGCATACAAAAAATTTGTTTGG - Intronic
1040931458 8:52739296-52739318 GTCTCTACTAAAAATTAGCTGGG + Intronic
1041032158 8:53747995-53748017 GTCTCTACTAAAAATTAGCTGGG + Intronic
1041061580 8:54039933-54039955 ATAACTACAACAATTTTGCTGGG + Intergenic
1041087531 8:54270723-54270745 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1041574252 8:59375315-59375337 GTTTCTACAAAATTTTGTCTTGG + Intergenic
1041619446 8:59949313-59949335 GTCTCTACAAAAAATTAGCTAGG + Intergenic
1041821988 8:62046325-62046347 TTCTCTCCAAATATTTTGCTGGG + Intergenic
1041888335 8:62839783-62839805 TTTTTTACAAAAATTTTGTTAGG + Intronic
1042119397 8:65468469-65468491 TTGTTTACAAGAATTTTGCCAGG - Intergenic
1042129282 8:65571118-65571140 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1042207411 8:66343278-66343300 GTCTCTACAAAAACCTAGCTGGG + Intergenic
1042513691 8:69637648-69637670 GTTTCTAAAAAAATTTTGCTGGG + Intronic
1042893247 8:73636214-73636236 ATATCTACAAAAAATTAGCTGGG + Intronic
1043952023 8:86320105-86320127 GTCTCTACAAAAAATTAGCCAGG - Intronic
1044236495 8:89837167-89837189 GTGTTTAAAAAAAATATGCTGGG - Intergenic
1044255583 8:90056725-90056747 GTCTCTACAAAAAGTTAGCTAGG - Intergenic
1044689849 8:94866451-94866473 ATCTCTACAAAAAATTAGCTGGG - Intronic
1044747583 8:95385624-95385646 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1044844670 8:96368870-96368892 ATATCTACAAAAATCTTGCTGGG + Intergenic
1044939541 8:97326859-97326881 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1044974893 8:97654929-97654951 GTCTCTACAAAAAATTAACTAGG + Intronic
1044976100 8:97667151-97667173 GTCTCTACAAAAAATTAGCTGGG - Intronic
1045087753 8:98705250-98705272 GTCTCTACAAAAAATTAGTTGGG + Intronic
1045204782 8:100027058-100027080 GTCTCTACAAAACATTAGCTGGG + Intronic
1045946906 8:107806593-107806615 GTGTCTAGAAAATTTCTTCTAGG - Intergenic
1046645154 8:116777770-116777792 TGGACTACAATAATTTTGCTTGG + Intronic
1046793709 8:118348235-118348257 GTCTCTACAAAAATTTAGCCAGG - Intronic
1047414431 8:124652332-124652354 GTCTCTACAAAAAATTAGCCAGG - Intronic
1047420030 8:124699976-124699998 GTGTCTACAAAAAATTAGCCAGG + Intronic
1047516741 8:125561649-125561671 ATTTCTACAAAAAATTAGCTGGG - Intergenic
1048425978 8:134323839-134323861 ATGTCTACTAAAAATTAGCTGGG - Intergenic
1048665840 8:136660398-136660420 ATATCTACAAAGATTTTGCTGGG - Intergenic
1048799092 8:138179847-138179869 GTCTCTACAAAAAGTTGTCTGGG - Intronic
1049822328 8:144643291-144643313 GTCTCTACAAAAAAATTGCCAGG + Intergenic
1049970492 9:817846-817868 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1049977197 9:871194-871216 GTCTCTACAAAAAATTAGCCGGG - Intronic
1050294753 9:4194611-4194633 GTGTCTATAATGATTCTGCTGGG - Intronic
1050347020 9:4700314-4700336 GTCTCTACAAAAAATTAGCTGGG - Intronic
1051118074 9:13720215-13720237 GGGTCAACAATAATGTTGCTGGG - Intergenic
1051288893 9:15525743-15525765 GTATCTGTAAAAGTTTTGCTGGG + Intergenic
1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1051934839 9:22434147-22434169 GTGTTTACAAACTTTTAGCTAGG - Intergenic
1052817970 9:33116390-33116412 GTCTCTACTAAAAATTAGCTGGG - Intronic
1054776169 9:69125465-69125487 GTCTCTACTAAAAATTAGCTGGG - Intronic
1054784108 9:69194190-69194212 GTGTCTCTAAAATTTTTCCTGGG - Intronic
1055323859 9:75108062-75108084 GTCTCTACAAAAAATGAGCTGGG + Intronic
1055593022 9:77838016-77838038 GTCTCTACTAAAAATTAGCTGGG - Intronic
1056648024 9:88431878-88431900 TTCTCTACAAAAAATTAGCTGGG + Intronic
1057067389 9:92068051-92068073 CTGTCTTCATAAATTTTGCCAGG + Exonic
1057133657 9:92671653-92671675 GTCTCTACAAAAAATTAGCAGGG + Intergenic
1057390333 9:94637557-94637579 GTCTCTACCAAAAATTAGCTGGG - Intronic
1057808520 9:98239217-98239239 ATCTCTACAAAAAATTAGCTGGG - Intronic
1058398247 9:104581237-104581259 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1058403535 9:104644472-104644494 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1058855591 9:109058772-109058794 ATCTCTACAAAAAATTAGCTGGG - Intronic
1059233649 9:112743964-112743986 GTTTCTACAAAAACTTAGCTGGG - Intergenic
1059511767 9:114855050-114855072 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1059566569 9:115388404-115388426 ATCTCTACAAAAACTTAGCTGGG - Intronic
1060038398 9:120278791-120278813 GGCTCTACAAAAAATTAGCTGGG + Intergenic
1060693900 9:125689576-125689598 ATCTCTACAAAAAATTAGCTGGG + Intronic
1060841036 9:126793304-126793326 GTTTCTACAAAAGATTAGCTGGG + Intergenic
1061315238 9:129791455-129791477 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1061356038 9:130105828-130105850 CTGTCTACAAAAAATTGGCTGGG - Intronic
1061539778 9:131271875-131271897 GTGTCTCCAACAATTTGGATGGG + Intronic
1061691837 9:132339312-132339334 ATCTCTACAAAAAATTAGCTGGG + Intronic
1061761303 9:132853623-132853645 CAGTCTACAAAAAATTAGCTGGG + Intronic
1185662949 X:1741524-1741546 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1185952080 X:4448639-4448661 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1186371780 X:8954417-8954439 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1186405112 X:9294998-9295020 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1186494708 X:10002907-10002929 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1186541264 X:10402998-10403020 ATTTCTACAAAAAATTTGTTAGG + Intergenic
1186750545 X:12617300-12617322 GTATCCATAAATATTTTGCTGGG + Intronic
1186821962 X:13297948-13297970 GTGTATACAAATATTATGGTGGG - Intergenic
1187071920 X:15897007-15897029 GTCTCTACAAAAAATTAGTTGGG + Intergenic
1187244408 X:17540909-17540931 GTCTCTACAAAAAATTAGCTGGG + Intronic
1187359580 X:18612497-18612519 GTCTCTACAAAAAATTAGCCAGG + Intronic
1187408403 X:19024941-19024963 GTCTCTACAAAAAATTAGCCAGG - Intronic
1187540849 X:20192759-20192781 ATCTCTACAAAAAATTAGCTGGG - Intronic
1187545580 X:20248641-20248663 GTTTATACAAAAAATTAGCTGGG - Intronic
1188246753 X:27844541-27844563 CTGTCTACAAAAAACTTGCTGGG + Intergenic
1188275867 X:28199531-28199553 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1188290284 X:28379350-28379372 GTGTTTTCAAAATGTTTGCTTGG + Intergenic
1188386480 X:29566107-29566129 GTCTCTACAAAAAATTAGCCGGG - Intronic
1188914175 X:35889814-35889836 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189195863 X:39151991-39152013 GTGACTACAAAGATTTCTCTGGG - Intergenic
1189490310 X:41466257-41466279 TTGTCTACATAAAATTAGCTGGG + Intronic
1189807811 X:44752849-44752871 GTCTCTACAAAAAGTTAGCTGGG + Intergenic
1189943103 X:46147598-46147620 ATGTGCACAAAAAATTTGCTGGG + Intergenic
1189964710 X:46360948-46360970 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1190024283 X:46909058-46909080 GTATCTACGAAAACCTTGCTGGG - Intergenic
1190051276 X:47151197-47151219 GTCTCTACAAAAAATTAGCTGGG - Intronic
1190091407 X:47440669-47440691 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1190121241 X:47661022-47661044 ATTTCTACAAAAAATTAGCTGGG - Intergenic
1190164619 X:48062777-48062799 GTCTCTACAAAAAATTAGCCGGG + Intronic
1190191160 X:48278341-48278363 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1190307318 X:49091958-49091980 GTCTCTACAAAAAATTAGCCAGG + Intronic
1190364930 X:49683421-49683443 ATGTCTACAAAAAACTTGATGGG + Intergenic
1190555635 X:51632176-51632198 ATGTCTGCAAGAACTTTGCTGGG + Intergenic
1190769026 X:53499763-53499785 GTCTCTAAAAAAATTTTTTTTGG - Intergenic
1190777942 X:53569185-53569207 GTCTCTACAGAAAATTAGCTGGG - Intronic
1191186752 X:57621219-57621241 GTGTCTGTCAAAATCTTGCTGGG - Intergenic
1191778180 X:64841212-64841234 ATGTCTGGTAAAATTTTGCTGGG + Intergenic
1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG + Intronic
1192526348 X:71848202-71848224 GTCTCTACAAAAAATTGGCCAGG + Intergenic
1192541566 X:71977579-71977601 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1192674270 X:73178554-73178576 ATATCTACAAATAGTTTGCTGGG - Intergenic
1192705108 X:73520963-73520985 GTTTCAACATAAATTTTGGTGGG + Intergenic
1192860148 X:75059307-75059329 ATCTCTACAAAAAATTAGCTAGG + Intronic
1193095725 X:77546650-77546672 GTCTCTACAAAAAATTAGCCAGG - Intronic
1193465189 X:81839684-81839706 TTGTCTACCAAACTTTTTCTTGG + Intergenic
1193565390 X:83069871-83069893 TTGTCAAGAAACATTTTGCTGGG + Intergenic
1193577651 X:83222261-83222283 GTGTTTTTAAAAATGTTGCTGGG + Intergenic
1193834612 X:86326304-86326326 ATCTCTACAAAAAATTAGCTGGG + Intronic
1194760198 X:97787412-97787434 ATAACTACCAAAATTTTGCTGGG + Intergenic
1195196402 X:102501539-102501561 GTCTCCACAAAAAATTAGCTGGG - Intergenic
1195279480 X:103317251-103317273 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1195995618 X:110728964-110728986 GTTTCTACAAAAAATTAGCCAGG + Intronic
1196086853 X:111692947-111692969 GTCTCTACAAAAAATTAGCCAGG - Intronic
1196135401 X:112203782-112203804 ATGTCTAAAATAATTTTGCTAGG + Intergenic
1197009124 X:121539442-121539464 GACTTTACAAAAATTATGCTTGG - Intergenic
1197073648 X:122329974-122329996 ATGTCCAGAAAAATTTTCCTAGG - Intergenic
1197254448 X:124247633-124247655 GTGTCTACAAAAAATTAGCCAGG - Intronic
1197263433 X:124340442-124340464 CAGTCTACAAAAAGGTTGCTAGG + Intronic
1198119689 X:133579702-133579724 GTCTCTACAAAAAATTAGCTGGG - Intronic
1198477473 X:137009403-137009425 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1198652203 X:138875069-138875091 GTCTCTACTAAAAATTAGCTGGG + Intronic
1199382560 X:147187479-147187501 ATGTCTACAAATATTTTTCTGGG + Intergenic
1199384779 X:147211002-147211024 ATGTCTACAAATATTTTTCTGGG + Intergenic
1199454539 X:148013598-148013620 GTCTCTACTATAATTTTGTTAGG - Intronic
1200641566 Y:5725104-5725126 GTCTCTACTAAAAATTAGCTGGG + Intronic
1200750357 Y:6939326-6939348 GTGTTTACAAACCTTTAGCTAGG + Intronic
1201380985 Y:13378853-13378875 GTCTCTACAAAAAATTAACTGGG - Intronic
1201414874 Y:13738404-13738426 GTCTCTACAAAAATTATCCGGGG + Intergenic
1201738770 Y:17301162-17301184 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1201752900 Y:17453274-17453296 GTGTCTAAAAATATTTTCTTGGG + Intergenic
1201788846 Y:17815839-17815861 GTATTTACAAATATTTTACTGGG + Intergenic
1201812707 Y:18090148-18090170 GTATTTACAAATATTTTACTGGG - Intergenic
1201854307 Y:18524187-18524209 GTCTCTACAAAAATGTAGCCGGG + Intergenic
1201879014 Y:18796198-18796220 GTCTCTACAAAAATGTAGCCGGG - Intronic
1202334131 Y:23789202-23789224 GTATTTACAAATATTTTACTGGG + Intergenic
1202338751 Y:23837890-23837912 ATGTCGAGAAAAATGTTGCTGGG - Intergenic
1202532015 Y:25832182-25832204 ATGTCGAGAAAAATGTTGCTGGG + Intergenic
1202536637 Y:25880857-25880879 GTATTTACAAATATTTTACTGGG - Intergenic
1202604757 Y:26629295-26629317 GTCTCTACAAAAAATTAGCTGGG + Intergenic