ID: 999907296

View in Genome Browser
Species Human (GRCh38)
Location 5:156155913-156155935
Sequence AAGAGGAAACAGAAGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999907292_999907296 8 Left 999907292 5:156155882-156155904 CCTTGCTGCACAGGCAGCACACC 0: 1
1: 0
2: 1
3: 26
4: 195
Right 999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG No data
999907291_999907296 16 Left 999907291 5:156155874-156155896 CCTGTCAGCCTTGCTGCACAGGC 0: 1
1: 0
2: 2
3: 17
4: 214
Right 999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999907296 Original CRISPR AAGAGGAAACAGAAGGTTGC AGG Intronic
No off target data available for this crispr