ID: 999909348

View in Genome Browser
Species Human (GRCh38)
Location 5:156180701-156180723
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 2, 1: 3, 2: 31, 3: 82, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900812770 1:4820554-4820576 CAAAACATTAGACTTCAAGAAGG - Intergenic
900845113 1:5092116-5092138 CAAATTATTAAACCTTAAGAAGG - Intergenic
901179166 1:7328568-7328590 CAAATGATCTGACTTCAAGAAGG - Intronic
901727629 1:11254440-11254462 CTTATTATGAGAATTGAAGCTGG - Intronic
903237477 1:21959545-21959567 CAAATTATTAAACCTGAGGAGGG + Intergenic
903784455 1:25849013-25849035 CAAATTATGAAACCTGAGAATGG + Intronic
904161428 1:28524856-28524878 CAAATTATGAGAGTAAAAAAGGG + Intronic
907020588 1:51063039-51063061 GAAATTATGAGACTCAAAGTAGG - Intergenic
907330371 1:53667031-53667053 CAAATTAAGACACTAGGAGAAGG - Intronic
907933792 1:59023911-59023933 CAAATTATGAGACATAAATCAGG + Intergenic
908333176 1:63091986-63092008 GAAATCATAAGACTTGAAGGTGG + Intergenic
909327474 1:74369068-74369090 CAATTTCTGAGAGCTGAAGATGG - Exonic
909542117 1:76802905-76802927 CAAATTATTAAACCTGAGGATGG - Intergenic
911031530 1:93494137-93494159 CAAATTATCAAACTGGAGGAGGG - Intronic
911148427 1:94573256-94573278 CAAATAATGAGAGTTTCAGAAGG - Intergenic
912359646 1:109084484-109084506 TAAATCTTGAGACTTAAAGAAGG - Intergenic
913240664 1:116826648-116826670 CAAAATAAGTCACTTGAAGAGGG + Intergenic
913524634 1:119679138-119679160 CAAATTATTGAACTTGAGGAGGG - Intronic
914350960 1:146839987-146840009 CAAAATATGAGGCATGGAGAAGG - Intergenic
914760379 1:150593855-150593877 CAAATTAAGAGAGCTGAAGAAGG + Intergenic
915032099 1:152889248-152889270 TAAATAATAAGACTTGAAGGTGG + Intergenic
915811901 1:158921767-158921789 CAAATTATGAAAATACAAGATGG - Intergenic
916303141 1:163298413-163298435 CAAAGTAGAGGACTTGAAGAGGG + Intronic
916998455 1:170328036-170328058 AAATTTATGAGACCTGAGGAAGG + Intergenic
917153361 1:171967906-171967928 CAAAGTATGAGACTCAAAGAGGG - Intronic
917211291 1:172634311-172634333 CAAATTATTGAACCTGAAGAGGG + Intergenic
918513940 1:185341852-185341874 CACAGTATGAGACTCAAAGAGGG + Intergenic
918686856 1:187428069-187428091 CAAATTATTGAACCTGAAGAAGG - Intergenic
919196636 1:194295303-194295325 TACCTTATGAGACTTGGAGAAGG + Intergenic
919415353 1:197301460-197301482 TAAATAATGAGACTTGAAGCCGG - Intronic
919629310 1:199944437-199944459 CAAATTATCAAACTGAAAGAAGG + Intergenic
921032635 1:211346879-211346901 CAATTTATGAAACAAGAAGATGG + Intronic
921058453 1:211562696-211562718 CACAATTTAAGACTTGAAGATGG + Intergenic
921243124 1:213207604-213207626 CAAAATATGAGACTCTAAGAAGG - Intronic
921440937 1:215185115-215185137 AAAATTAACAGATTTGAAGATGG - Intronic
921510342 1:216020907-216020929 CAAATTATCAACCCTGAAGAGGG + Intronic
921532357 1:216300378-216300400 CAAATTATGAGATTAGACAATGG + Intronic
922965290 1:229685414-229685436 CACATTATGAGAGTTCCAGAAGG - Intergenic
923029187 1:230233793-230233815 CAAAATATGAGACTCAAAGAAGG + Intronic
923112745 1:230905165-230905187 CAAATTATCAAACATGAGGAGGG + Intergenic
924140130 1:241013369-241013391 CAAAGTGTGAGACTCGAAGCAGG - Intronic
924213403 1:241793840-241793862 CATGTTATGAGACATGAAGCAGG - Intronic
924841752 1:247717988-247718010 CAAAATATGAGATTCAAAGAAGG + Intergenic
1064729383 10:18314491-18314513 TAATTTTTCAGACTTGAAGAAGG - Intronic
1066082014 10:31940410-31940432 CAAATCATTAGAATGGAAGAGGG + Intergenic
1066710515 10:38228413-38228435 CAAATTATTAAACTTGAGCAAGG + Intergenic
1066762292 10:38766961-38766983 CAAAGAATAAGACTTGAAGATGG - Intergenic
1066959298 10:42205509-42205531 CAAAGTATAAGACTTGAAGATGG + Intergenic
1067958768 10:50823753-50823775 CAAAAATTGAGACCTGAAGATGG - Intronic
1068366801 10:56061706-56061728 AAAATTATGAGAATGGAAGATGG + Intergenic
1069566877 10:69469355-69469377 CAAATTATCAAACTTGGAGAAGG + Intronic
1070725189 10:78782901-78782923 TAAATAATGAGACTTGACAAGGG - Intergenic
1070845244 10:79516981-79517003 CAAAAAATGAGACTGCAAGAAGG - Intergenic
1070928554 10:80243327-80243349 CAAAAAATGAGACTGCAAGAAGG + Intergenic
1071163197 10:82776539-82776561 CAGATTATGAGAGTTTCAGAGGG - Intronic
1071189489 10:83082863-83082885 CATATTATATGCCTTGAAGATGG - Intergenic
1071331890 10:84568705-84568727 CGAAATATGAGACTCAAAGAAGG - Intergenic
1072215607 10:93285014-93285036 CCAAATATGAGACTCGAACAAGG + Intergenic
1073976131 10:109103707-109103729 GAAATTATGCAATTTGAAGAGGG - Intergenic
1074938557 10:118211931-118211953 AAGAATATGAGACTGGAAGAAGG + Intergenic
1076044345 10:127279179-127279201 CAAATTACTAGACTTGTAGGTGG + Intronic
1076527680 10:131122702-131122724 CAAATTATCAAACTTGAAGGAGG + Intronic
1076977161 11:182510-182532 CAAATTGTCAAACCTGAAGAGGG - Intronic
1078324114 11:10365354-10365376 CAAATTATCAAACTTGGGGAGGG + Intronic
1078516325 11:12025773-12025795 CAAATTATTAAACCTGAGGAGGG - Intergenic
1078725111 11:13923336-13923358 CAAATTAGCAAACCTGAAGAGGG - Intergenic
1078761022 11:14252036-14252058 AAGATATTGAGACTTGAAGAGGG + Intronic
1078972778 11:16433662-16433684 AAACTCAGGAGACTTGAAGAAGG + Intronic
1079420220 11:20279110-20279132 CAAAATATGAGACTCAAAGAAGG + Intergenic
1079556710 11:21767629-21767651 CAAATAAGGAGAGTTGAAAAAGG + Intergenic
1079605733 11:22363647-22363669 CAAATTATTATGCTTGTAGAAGG + Intronic
1079980093 11:27141920-27141942 CAAATTATGAGAGTTCCAGAAGG + Intergenic
1080307589 11:30853548-30853570 CAAAATATGATACTCAAAGAAGG + Intronic
1080955684 11:37092387-37092409 CAAATTATGAAAAAGGAAGAGGG + Intergenic
1081434980 11:43017419-43017441 AAATTTATGAAACTTGGAGATGG + Intergenic
1082212523 11:49522568-49522590 GAAAATATGATACTTGAAGTGGG + Intergenic
1083028151 11:59568120-59568142 CAAAACACAAGACTTGAAGATGG + Intergenic
1083168682 11:60908752-60908774 CAAAATATGAGGCTCAAAGAAGG + Intergenic
1083371318 11:62184371-62184393 ACAATTATGAGTCTTGAGGATGG + Intergenic
1085516588 11:77115504-77115526 CAACTTCTCTGACTTGAAGAAGG - Exonic
1085811918 11:79690853-79690875 GAAAATATGATATTTGAAGAGGG + Intergenic
1085913395 11:80855539-80855561 CAAATGAAGAGAATTGAAGCCGG + Intergenic
1086121527 11:83309588-83309610 GAAATAATAAGACTTGAAAATGG + Intergenic
1086637073 11:89101929-89101951 GAAAATATGATACTTGAAGTTGG - Intergenic
1086719554 11:90103230-90103252 CAAAGTATAAGACTTGAAGATGG - Intergenic
1086834007 11:91599465-91599487 CAAAATAGGAGAGTTGAACAGGG - Intergenic
1087044359 11:93831699-93831721 CAAATTCTGAAACCTGATGAAGG - Intronic
1087221341 11:95549689-95549711 CATTTTATGAGACGAGAAGACGG - Intergenic
1087231939 11:95675976-95675998 AAAATAATGAGAATTGGAGAAGG + Intergenic
1087272454 11:96125345-96125367 CAGATGCTGAGACTTGGAGATGG - Intronic
1087686026 11:101266148-101266170 AAAATTATGAAAATTGATGATGG - Intergenic
1087994910 11:104793454-104793476 CAAATTATTTGACATGAGGAGGG + Intergenic
1089081461 11:115779577-115779599 GAAATTAAGAGACTTGCCGAAGG - Intergenic
1090287071 11:125509213-125509235 CAAAATATGAGATTCAAAGAAGG + Intergenic
1090289176 11:125526955-125526977 CAAAATATGAGACTCAAACAAGG - Intergenic
1090320650 11:125840444-125840466 CAAATTATTGCACTTGAGGAGGG - Intergenic
1090706029 11:129337732-129337754 CAAATTATCATACCTGAGGAGGG - Intergenic
1090948349 11:131451103-131451125 CTAATTCTGAAACTAGAAGAAGG - Intronic
1091104205 11:132903109-132903131 CATAATATGAGACTCAAAGAAGG - Intronic
1091608105 12:1975314-1975336 AAAATTATGGGTTTTGAAGAAGG - Intronic
1091920608 12:4301611-4301633 CATAGTATGAGGGTTGAAGACGG + Exonic
1092296702 12:7205740-7205762 CAATTGATGAGACTTCAAGGAGG + Intronic
1092642392 12:10528851-10528873 CAACTCATGAGACTAGAAAATGG + Intergenic
1093509905 12:19914227-19914249 CAAAATGTAAGACTTGAAGAAGG - Intergenic
1093552097 12:20425340-20425362 CACATGTTGAGACTTGAAGGAGG - Intronic
1094821272 12:34227720-34227742 GAAAGTATGAGTCTTGAAAAAGG - Intergenic
1095093630 12:38131066-38131088 GAAAGTATGAGTCTTAAAGAAGG + Intergenic
1095532398 12:43203673-43203695 AAAATTATGAGACATAAAGCAGG + Intergenic
1097806126 12:63966961-63966983 CAACTTATGAGACGTGAATATGG - Intronic
1098313320 12:69169069-69169091 CAAATTATGGAACCTGAAGGAGG - Intergenic
1099338467 12:81395920-81395942 CAATGTATTAGACTGGAAGAGGG - Intronic
1099508412 12:83506014-83506036 CCAAATAGGAGAGTTGAAGAGGG - Intergenic
1100043331 12:90346840-90346862 CAAAGTATGAAACTCAAAGAAGG + Intergenic
1100133708 12:91527901-91527923 CACAATATGAGACTCCAAGAAGG + Intergenic
1100258108 12:92904649-92904671 CAAATTATCAAACCTGAGGAGGG - Intronic
1100411817 12:94326343-94326365 CAAATTATCAAACTGGAGGAGGG + Intronic
1100427038 12:94497247-94497269 CAAAATATGAAACTTAGAGAAGG + Intergenic
1104692932 12:130839898-130839920 CAAATTATGGAACTTGAAGGTGG - Intergenic
1104694496 12:130852978-130853000 CAAATTATCAAACTTGAGGAGGG - Intergenic
1105622905 13:22086548-22086570 CAAATGATGAGCCTGGAGGAGGG + Intergenic
1105650310 13:22370170-22370192 CAAAATATGAGACTCAAAGAAGG - Intergenic
1106185866 13:27409085-27409107 CAATATATGAGACTTGAAGAAGG + Intergenic
1106272880 13:28171538-28171560 CAAATTATCAAACCTGAGGAGGG - Intronic
1106478920 13:30122243-30122265 CAAATGATGAGGCTTGAATGGGG - Intergenic
1106579343 13:31004055-31004077 CAAATCCTGAGCCCTGAAGATGG + Intergenic
1107107937 13:36667012-36667034 CTGTTTATGAGACTTGAAGCAGG - Intergenic
1107651623 13:42550794-42550816 CAAATTATGAGAATCGTAGATGG - Intergenic
1107664098 13:42671499-42671521 CAAACTGTGAGGCTCGAAGAGGG - Intergenic
1107985307 13:45770866-45770888 CAAAATATGAAACTCAAAGAAGG + Intergenic
1108009904 13:45995245-45995267 CAAAATTGGAGACTTGAGGAAGG - Intronic
1108504175 13:51095592-51095614 AAAATCAGCAGACTTGAAGATGG - Intergenic
1109087002 13:57986618-57986640 TTAAATATTAGACTTGAAGAAGG + Intergenic
1109360146 13:61284751-61284773 CAAAATCTGAGACTCAAAGAAGG + Intergenic
1109360208 13:61285595-61285617 CAAAATCTGAGACTCAAAGAAGG + Intergenic
1109992394 13:70075113-70075135 CAAATTATGAGACTTGAAGAGGG + Intronic
1110588578 13:77225551-77225573 CAAATTATAACACTTGCAGATGG - Exonic
1111101151 13:83588803-83588825 CAAATTATCACAATTGAGGAAGG - Intergenic
1113729926 13:112634057-112634079 CAAACTATGAAACCTGAAGAGGG - Intergenic
1114943802 14:27652002-27652024 CAAATTTTGTGAAATGAAGAGGG - Intergenic
1114986407 14:28234912-28234934 AAAATTCTGAAACTTGCAGAAGG - Intergenic
1115964669 14:38874368-38874390 CAAAATATGAGACTTAAAGAAGG + Intergenic
1118213071 14:63783852-63783874 CAATTTATGAAATTTGAACAGGG + Intergenic
1118376601 14:65182861-65182883 CAGAATAAGAGACTTGAAGAAGG - Intergenic
1118485470 14:66210654-66210676 CAAATTATCAAACTTTCAGAGGG + Intergenic
1119505443 14:75169050-75169072 CAAATAAAGAGAATGGAAGAGGG + Intronic
1120095856 14:80386822-80386844 CACATTATTAGAATAGAAGAAGG + Intronic
1120908485 14:89642993-89643015 AACATTATGTGACTTGAAGGTGG + Intergenic
1122755847 14:103979465-103979487 CACATGGTGAGACTGGAAGAAGG + Intronic
1202933625 14_KI270725v1_random:63214-63236 CAAAGTATAAGACTTGAAGATGG - Intergenic
1124895739 15:33775691-33775713 CAAGTTATGAGAATGGCAGATGG + Intronic
1124914561 15:33957063-33957085 CAAATTATTAAACTTTAAGAAGG - Intronic
1125170933 15:36765677-36765699 TAAATTATGGGATTTGAAAATGG + Intronic
1125281693 15:38048355-38048377 CAAATTATCAAACCTGAGGATGG + Intergenic
1126013594 15:44327875-44327897 GAAATTATGAGCTTTGAAAATGG + Intronic
1127145486 15:56018872-56018894 CAAATTATAAGATTCAAAGAAGG - Intergenic
1128903907 15:71450814-71450836 CAAAATATGAGACTCAAAGAAGG + Intronic
1129075962 15:72996387-72996409 CAAAATATGAGACTCAAAGAAGG + Intergenic
1129789937 15:78334284-78334306 TACATTATTAGTCTTGAAGAGGG - Intergenic
1130692419 15:86094996-86095018 CAAATTATCAAACCTGAAGACGG - Intergenic
1131830838 15:96353827-96353849 GAAATTAAGGGACTAGAAGAAGG + Intergenic
1132916663 16:2351077-2351099 CAAATTCTAACACTTAAAGAAGG - Intergenic
1135052199 16:19202266-19202288 CAAATTATTGAACTTGAGGAGGG - Intronic
1135276118 16:21114231-21114253 AGAATTTTGGGACTTGAAGAAGG - Intronic
1137576695 16:49604726-49604748 AAAATTCTGAGCCTTGAGGATGG - Intronic
1139983076 16:70875556-70875578 CAAAATATGAGGCATGGAGAAGG + Intronic
1140128833 16:72139732-72139754 CAAAGTTTGAGAATTAAAGAAGG + Intronic
1140329123 16:74036007-74036029 CACATTTAGAGACTGGAAGAAGG - Intergenic
1140545621 16:75805999-75806021 CAAACTATGAAACCTGAGGAAGG + Intergenic
1140746770 16:77987417-77987439 CAAATCATGCGACTAGAAGGTGG - Intergenic
1140876460 16:79157370-79157392 CAGTTTATGAGACTTGACCAAGG - Intronic
1142443095 16:90114170-90114192 CAAATTGTCAAACCTGAAGAGGG + Intergenic
1142464299 17:120679-120701 CAAATTGTCAAACCTGAAGAGGG - Intergenic
1144111889 17:12043571-12043593 CAAATTATCAAACTTGATGGGGG - Intronic
1144197266 17:12906473-12906495 CAAATTATCAAACCTGAGGAGGG - Intronic
1144273319 17:13640963-13640985 GAAAGTATGAGGCTTGAAGAGGG - Intergenic
1146828368 17:36044733-36044755 AAAATTGGTAGACTTGAAGATGG - Intergenic
1147517249 17:41131680-41131702 CAAACTATAAGACTTGAAGAAGG - Intergenic
1147710033 17:42456673-42456695 CCATTTCTGAGTCTTGAAGAAGG + Intergenic
1148997278 17:51721953-51721975 CAAATTATCAAACATGAAGAGGG + Intronic
1149010527 17:51851923-51851945 CAAAATATGAGGATTTAAGATGG - Intronic
1149927149 17:60712760-60712782 TAAAATATGAGACTCAAAGAAGG + Intronic
1151255265 17:72871792-72871814 CAAATGATCAAACTTGAGGAGGG + Intronic
1151861923 17:76770671-76770693 CAAATTATCAAACATGAAGGGGG - Intronic
1152395008 17:80027141-80027163 CAAATCCTGAGAGATGAAGATGG + Intronic
1203166966 17_GL000205v2_random:106420-106442 CAAATTATTTAACTTGAAAAGGG + Intergenic
1153161790 18:2214277-2214299 AAAATTATCAGAGTTTAAGAAGG + Intergenic
1153368864 18:4290756-4290778 CAAGTTATGAGTATTGAAAAGGG + Intronic
1153585704 18:6617866-6617888 AAAAATATGAGACTCAAAGAAGG + Intergenic
1153830907 18:8921792-8921814 AAAAATATGAGACTCAAAGAAGG + Intergenic
1155174086 18:23287970-23287992 GAAATTATGAGAGCTGTAGAGGG - Intronic
1155448491 18:25938460-25938482 CAAAATATGAGACTCAAAGAAGG + Intergenic
1156117797 18:33807724-33807746 AAAATCATGAGACTTTAAAAAGG + Intergenic
1156787733 18:40935884-40935906 TGAATTATGAGACTTGAGAATGG + Intergenic
1156815803 18:41309653-41309675 CAAAATATGAGAGTTGAGGAGGG - Intergenic
1156905094 18:42342760-42342782 AAAACTATGAGACTCAAAGAAGG - Intergenic
1156948645 18:42866425-42866447 AAAATTAAGAGACTGCAAGAAGG - Intronic
1157775685 18:50394203-50394225 CAAATTATCAAACCTGAGGAGGG + Intergenic
1157975701 18:52324420-52324442 CAAATTATCAAACATGAAGAAGG + Intergenic
1158130443 18:54147109-54147131 CAAATTATCAAACTTGAGGGTGG + Intergenic
1158210267 18:55041017-55041039 CAAAGTATGAGACTCAAAGAGGG - Intergenic
1158931345 18:62326948-62326970 CAAAATAAGAGACTTGAGGAAGG + Intronic
1159033082 18:63251096-63251118 CAAAATATGAGACTTGAAGAAGG + Intronic
1159175187 18:64824022-64824044 CAAACTATAAGATATGAAGAGGG + Intergenic
1159377765 18:67615717-67615739 GAAAATATGAGACTTAAAGAAGG - Intergenic
1159743121 18:72198396-72198418 CAATTTATGATGTTTGAAGAAGG - Intergenic
1160552179 18:79701191-79701213 TAAATAATAAGACTTGAAGCTGG - Intronic
1162574349 19:11490138-11490160 CAAATTATCAAACCTGAGGATGG - Intronic
1162629641 19:11917021-11917043 CAAATTATGGAACTTGAGTAAGG + Intergenic
1162634694 19:11958251-11958273 CAAATTATGGAACTTGAGTAAGG + Intronic
1163175729 19:15563185-15563207 AGAATTAGGAGACTTGGAGAAGG - Intergenic
1163249685 19:16119107-16119129 CAAACTTTGAGACTTGAGGGAGG - Intronic
1164022757 19:21322963-21322985 CAAATTATTGAACTTGAAAAAGG - Intronic
1164070037 19:21759181-21759203 CAAATTATTGAACTTGAGGAAGG - Intronic
1164135454 19:22410948-22410970 AAGATTATGATACTTTAAGATGG - Intronic
1164136159 19:22418257-22418279 CAAATTATGAAACTTGAGGGAGG - Intronic
1164163092 19:22643365-22643387 AAGATTATGATACTTTAAGATGG + Intronic
1165014749 19:32872490-32872512 CAAAACAAGAGACTTGAAGAAGG + Intergenic
1165880174 19:39036914-39036936 CAAAGTATGAGATTCAAAGAAGG - Intergenic
1168520996 19:57050416-57050438 CAAATTATCAAACCTGAGGAGGG - Intergenic
925295472 2:2773594-2773616 AAAATTATCAAACTTGAGGAGGG + Intergenic
925401747 2:3578716-3578738 TAAATCATGACACTTAAAGAGGG + Intronic
926114282 2:10202376-10202398 CCAAATGTAAGACTTGAAGAAGG + Intronic
926367470 2:12146248-12146270 CAAATTATCAAACCTGAGGAGGG - Intergenic
927805837 2:26145753-26145775 CAAATAATAAGGCTTGAAGAGGG - Intergenic
928715702 2:34057119-34057141 TTGATTATGAGAGTTGAAGAAGG - Intergenic
929145340 2:38702516-38702538 GAAAGTATGACTCTTGAAGAAGG - Intronic
930085747 2:47495878-47495900 CAAATTATCAAACATGAAGAGGG - Intronic
930445400 2:51464638-51464660 CAAATTATTATCCTTGAAAAGGG - Intergenic
930571543 2:53092589-53092611 CAAATTAAGATAATTCAAGAAGG + Intergenic
931025783 2:58112628-58112650 GAAAATATGAGACTCAAAGAAGG + Intronic
931565765 2:63614240-63614262 CAAAATATGAAACTCAAAGAAGG - Intronic
931728515 2:65132786-65132808 CAAAATAAGAGACTCCAAGAAGG + Intergenic
933071517 2:77864434-77864456 CAAAATATAAGACTCAAAGAGGG - Intergenic
933663285 2:84944820-84944842 CAAATTATTGAACATGAAGAGGG + Intergenic
934325604 2:92011576-92011598 CAAAGTATAAGACTTGAAGATGG - Intergenic
934463959 2:94242206-94242228 CAAAGTATAAGACTTGAAGATGG - Intergenic
934697691 2:96411849-96411871 CAAAATATAAGACTCAAAGAAGG - Intergenic
935235961 2:101138566-101138588 CAAATTATCAAACCTGAGGATGG - Intronic
936835972 2:116709929-116709951 CAAAGTGTGAGACTAGAGGAAGG + Intergenic
936907308 2:117551764-117551786 GAAATGATGACACTTGAAGTTGG + Intergenic
937014608 2:118593278-118593300 CAAATTATTTCACTAGAAGAAGG - Intergenic
937152866 2:119697873-119697895 CAAAATATGAGGCTCAAAGAAGG + Intergenic
937305962 2:120871015-120871037 CAAATCCTGGGACTTGAATAAGG + Intronic
937357084 2:121204633-121204655 CAAATTATTGAACTTGAGGATGG + Intergenic
937665285 2:124480153-124480175 CAAACTATGAGTCATGAAGTGGG + Intronic
940341709 2:152588421-152588443 CAAATTAAGGGACTTCAGGAGGG - Intronic
940651108 2:156441610-156441632 CAAATTATCAAATTTGAGGATGG + Intronic
941781183 2:169447342-169447364 CAAATTATTGAACGTGAAGAGGG + Intergenic
942410667 2:175705999-175706021 GAAGTTAGGAGATTTGAAGAAGG - Intergenic
942833903 2:180269369-180269391 CAAACTATAAGAATTGTAGAAGG - Intergenic
943009857 2:182434004-182434026 CAGATTATGATACTTGCTGAGGG - Intronic
943399105 2:187382304-187382326 TACATTATGAAACTTCAAGAAGG + Intronic
943608626 2:190006046-190006068 CAAAGTATGATACTTAAAGGTGG + Intronic
944714026 2:202361146-202361168 CAAAATATGAAACTCAAAGAAGG - Intergenic
945607214 2:211949832-211949854 GAAAATATGAGAATTGAAGCAGG - Intronic
945732393 2:213554873-213554895 CAAGTTATAAGAGTTTAAGAAGG + Intronic
945809589 2:214532561-214532583 GAAATTAGGAGACAAGAAGAAGG + Intronic
946286425 2:218707067-218707089 CAAAATATGAGACTCAAAGAAGG + Intergenic
946905188 2:224408769-224408791 CAAAATATGAGGCTCAAAGAAGG + Intergenic
947471297 2:230403660-230403682 CGAAATATGAGACTCCAAGAAGG - Exonic
947513444 2:230780384-230780406 CAACTGATGAAACTTGAAAAAGG - Intronic
947547175 2:231018477-231018499 CAAACTATGAGACTAAAAGAGGG - Intronic
947782231 2:232778685-232778707 CAAAACATGAGACTTGAGGAAGG + Intronic
947986975 2:234456632-234456654 CAAAATATGAGACTCAAAGAAGG + Intergenic
948937128 2:241173981-241174003 AAAATTACAAGACGTGAAGAAGG - Intronic
1168821795 20:778453-778475 CAAAATATGAGACTCAAAGAAGG - Intergenic
1169976471 20:11334451-11334473 CAAATTATGGAAGTTTAAGAAGG + Intergenic
1170209660 20:13835889-13835911 CAAATTATCAAACCTGAGGAGGG + Intergenic
1170794550 20:19535121-19535143 CAATTAATGAGCCTTGAGGATGG - Intronic
1170897211 20:20426431-20426453 AAAATAATGAGTCTTGATGAAGG + Intronic
1171034035 20:21702480-21702502 CCAAGTATGAGACATGAAGTGGG + Intergenic
1171993692 20:31716116-31716138 CAAAATATGAGGCTCAAAGAAGG - Intronic
1173212775 20:41049668-41049690 CTTATTATGAAACTTGATGAGGG + Intronic
1173313275 20:41919781-41919803 TAAATAATAAGACTTGAAAACGG + Intergenic
1173615252 20:44399196-44399218 CACACTATGAGACTTGATAAGGG - Intronic
1173633362 20:44532906-44532928 CAGATTATGAGAGTTGGAGGGGG + Intronic
1173774750 20:45695103-45695125 CAAATTATCAAACTTTCAGATGG + Intronic
1176334599 21:5584140-5584162 CAAATTATTTAACTTGAAAAGGG - Intergenic
1176393158 21:6236808-6236830 CAAATTATTTAACTTGAAAAGGG + Intergenic
1176404791 21:6352679-6352701 CAAATTATTTAACTTGAAAAGGG - Intergenic
1176432366 21:6636425-6636447 CAAATTATTTAACTTGAAAAGGG + Intergenic
1176468261 21:7079366-7079388 CAAATTATTTAACTTGAAAAGGG - Intronic
1176491822 21:7461144-7461166 CAAATTATTTAACTTGAAAAGGG - Intergenic
1176508820 21:7677239-7677261 CAAATTATTTAACTTGAAAAGGG + Intergenic
1176595025 21:8685370-8685392 CAAAGTATAAGACTTGAAGATGG - Intergenic
1176985031 21:15425880-15425902 CAAAATATGAAACTCAAAGAAGG - Intergenic
1177013278 21:15753830-15753852 CAAAATAAGAGACTTGAAGAAGG + Intronic
1177709721 21:24757620-24757642 CATATTTTGAGAATTGAAGCTGG - Intergenic
1177968799 21:27762013-27762035 CAAAATATGAGACTTGAAAAGGG - Intergenic
1178353733 21:31893139-31893161 CAGAATATGAGACTCCAAGAAGG + Intronic
1180277878 22:10662528-10662550 CAAAGTATAAGACTTGACAATGG - Intergenic
1180585111 22:16881361-16881383 CAAAGTATAAGACTTGAAGATGG - Intergenic
1180974077 22:19836187-19836209 CAAATTATAATAATTAAAGAAGG + Intronic
1183756426 22:39770513-39770535 CAAATTTAGAAGCTTGAAGAAGG - Intronic
951436052 3:22666097-22666119 CAAATTAGGATACTTCGAGATGG + Intergenic
953744781 3:45566066-45566088 CAAAGTTTAAGACTTGAAGAGGG + Intronic
954563673 3:51580179-51580201 CAAATTATTAAACCTGAGGAGGG - Intronic
954944013 3:54401272-54401294 CATATTAGGAGAATTGCAGAAGG + Intronic
955702726 3:61697807-61697829 CAAAATATGAGACTCAAAGAAGG - Intronic
956358468 3:68419537-68419559 TAAATTATGAAACATAAAGATGG - Intronic
956398186 3:68847746-68847768 CAAATTAGCAGATTTGAACACGG + Intronic
957826543 3:85453434-85453456 TAAAATATGTGAATTGAAGAGGG - Intronic
957877968 3:86174052-86174074 CAAAGTATGAGACTTTAAGAAGG + Intergenic
958449055 3:94250880-94250902 CAAAATATGAGACACAAAGAAGG + Intergenic
958468917 3:94494058-94494080 GAAATGATGAGCCTTCAAGAAGG - Intergenic
958673192 3:97231524-97231546 TAAAACATGAGACTTGTAGAAGG + Intronic
959062499 3:101628765-101628787 CAAATCATGAGACATAAAGAAGG + Intergenic
960479894 3:118174986-118175008 CAAATTATTGGACATGAGGAGGG + Intergenic
960766790 3:121139735-121139757 AAATGTATGAAACTTGAAGAGGG + Intronic
960775312 3:121244422-121244444 CACATTATGGGAATTTAAGAAGG + Intronic
961498508 3:127313076-127313098 CAAATTATTAAACATGAGGAGGG - Intergenic
962402716 3:135075124-135075146 CAAAGTATGAGCCTTTAAGCAGG + Intronic
963593440 3:147293994-147294016 CAAATTATGAGAAAAGAATAAGG - Intergenic
963849909 3:150200871-150200893 CACAATATGAGACTCAAAGAAGG - Intergenic
963982939 3:151560414-151560436 AAAAATATGAGACTGTAAGAAGG - Intergenic
964928612 3:161987432-161987454 CAATTTATGAGACTGCAAGCAGG + Intergenic
965341610 3:167498361-167498383 CAAAATATGAGACTCAAAGAAGG + Intronic
966094818 3:176187164-176187186 GAAATGAAGAGATTTGAAGATGG - Intergenic
966737078 3:183195595-183195617 CAAATTATGTGACTTGATGAGGG + Intronic
967452406 3:189641507-189641529 AAAATTATGAACCTAGAAGATGG - Intronic
967916944 3:194585712-194585734 CAAATAATTAGACCTGCAGATGG - Intergenic
968363410 3:198165548-198165570 CAAATTGTCAAACCTGAAGAGGG + Intergenic
968881999 4:3305756-3305778 CAAATCATGACACTTGAACAAGG - Intronic
970583415 4:17493520-17493542 CAAATTATTGCACCTGAAGAGGG - Intronic
970803116 4:20000163-20000185 CAAATTATCACACTTAAACAAGG + Intergenic
971146384 4:23980994-23981016 CATATTAGAAAACTTGAAGAAGG - Intergenic
971378478 4:26074614-26074636 AAAATCATCAGTCTTGAAGAGGG + Intergenic
971546670 4:27895126-27895148 CATATTATGAGGCTGCAAGAAGG - Intergenic
971971707 4:33629546-33629568 CAAATTATATGACATGAAAAGGG - Intergenic
973229953 4:47829498-47829520 CAAATTATCAAACCTGAAGAGGG + Intronic
974433827 4:61832157-61832179 CAATGTATGAGACTTGGAGAGGG + Intronic
974677142 4:65107026-65107048 CAAATGATCTGACTTGAAAATGG + Intergenic
974734894 4:65917278-65917300 CAAATCATTAAACATGAAGAGGG + Intergenic
975208145 4:71667922-71667944 AAAAATATGAGACTTGAAGAAGG + Intergenic
975760482 4:77614867-77614889 CAAATTATCAAACCTGAGGAGGG + Intergenic
976302064 4:83524713-83524735 CAAAATATGGAACTTGAAAAGGG - Intergenic
976537595 4:86236402-86236424 CAAATGATATGACTGGAAGAAGG + Intronic
976789640 4:88863504-88863526 CAAATTATCAAACCTGAAGTTGG + Intronic
977114277 4:93002955-93002977 ACAATTAGGAGACGTGAAGATGG - Intronic
977237383 4:94525109-94525131 CATATTATGAATCTTTAAGAGGG + Intronic
977673051 4:99717560-99717582 CAAAATATAAGACTCAAAGAAGG - Intergenic
979610850 4:122687371-122687393 CAAATTATCAGACCTAAGGAGGG + Intergenic
979746366 4:124218454-124218476 CAAAATTTAAAACTTGAAGAAGG - Intergenic
980228718 4:130020278-130020300 TAAATTATGGAACCTGAAGAAGG - Intergenic
980270529 4:130578188-130578210 TAAAATATGAGACTTGTAAATGG - Intergenic
981252127 4:142615962-142615984 CAAAATATGAGACTTAAAGAGGG + Intronic
981398360 4:144281524-144281546 TAAATTAAGAGACTGTAAGAAGG - Intergenic
981867834 4:149446810-149446832 AAAACTATGAAACCTGAAGATGG + Intergenic
982045866 4:151445112-151445134 CAAATTATCAAACCTGAGGAAGG - Intronic
982094191 4:151906201-151906223 AAAAATATGAGGCTTAAAGATGG + Intergenic
982141388 4:152323045-152323067 AAAACTATGGGACTTGAAAACGG - Exonic
982754748 4:159204780-159204802 CAAATTCTGAGATTCTAAGAAGG + Intronic
983053674 4:163077736-163077758 CAAAGAATGAGACTCAAAGAGGG + Intergenic
983249635 4:165329166-165329188 AAAAATATGAGAATTGAAGCTGG - Intronic
984563224 4:181295932-181295954 CAAAGTATGAGACTGAAAGAAGG + Intergenic
984859421 4:184223807-184223829 AAAAATATGAGACCTGAAGAAGG + Intergenic
985265090 4:188149723-188149745 CAGAGTTTGAGACTTGCAGAGGG + Intergenic
987263169 5:16224022-16224044 GACATTAATAGACTTGAAGAAGG - Intergenic
987574175 5:19704486-19704508 CAACATATGATACGTGAAGAGGG + Intronic
987806059 5:22769715-22769737 CAAATGAAGAGACTTGGGGATGG + Intronic
988069669 5:26271524-26271546 CAAATTAGGAAACTAGAAAAAGG - Intergenic
988131409 5:27111417-27111439 CAAATTATGCCACTTGAAGAAGG + Intronic
988474359 5:31570199-31570221 CAAACTATGAGACTCAAAGAAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988666583 5:33335493-33335515 CAAATGCTGAGGCTTGGAGAAGG + Intergenic
988829890 5:34977179-34977201 CAAATTATCAAACCTGAAGAGGG - Intergenic
989066432 5:37467309-37467331 CAAATTATGTTTCTTAAAGAGGG + Intronic
989126220 5:38054712-38054734 CAAATTATCAAACCTGAAAAAGG + Intergenic
989358355 5:40570750-40570772 CAAATTAAGAGACTTGGCTAAGG + Intergenic
990070191 5:51772950-51772972 CAAATTAGTAAACTTCAAGAAGG + Intergenic
990925269 5:61014496-61014518 GAAATTATCAGACTTGAGGAGGG + Intronic
990980602 5:61599591-61599613 CAATTTGTGAGACTTGGAGATGG + Intergenic
991127114 5:63081681-63081703 CAAAGTAAGAGACTTGAAAAAGG - Intergenic
991550965 5:67835419-67835441 CAAACCATGTGACTTGAGGAGGG - Intergenic
991737200 5:69638845-69638867 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991739637 5:69656877-69656899 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991788774 5:70218571-70218593 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991791212 5:70236618-70236640 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991813525 5:70493677-70493699 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991816657 5:70514960-70514982 CAAATTATGTTTCTTAAAGAGGG - Intergenic
992541169 5:77765630-77765652 CAAATTCAAAGACTTGAAAAAGG - Intronic
992738194 5:79744913-79744935 CACATGATGAAACTTGAAAATGG - Intronic
992772615 5:80062458-80062480 GAAATTATTAGCTTTGAAGAAGG + Intronic
993437261 5:87913090-87913112 GACATTATGAGAGTTGCAGAAGG + Intergenic
994120857 5:96111124-96111146 CAAATTATCAGACTTGAGGAGGG - Intergenic
994238892 5:97396909-97396931 CAAAATATGAGACACAAAGAAGG + Intergenic
994693013 5:103041345-103041367 TAAATTATTCTACTTGAAGACGG - Intergenic
994837720 5:104877183-104877205 CAAATAAAGACACTTGAAAATGG - Intergenic
994893531 5:105670671-105670693 CAAATTATCATACTTAGAGAGGG + Intergenic
995119541 5:108521074-108521096 CAAAATATGAGACTCAACGAAGG + Intergenic
996507660 5:124286501-124286523 CAAAATATGAGACTCAAAGAAGG + Intergenic
996543726 5:124655866-124655888 CAAATAATTATATTTGAAGAAGG - Intronic
996866115 5:128124454-128124476 CAAATTATCAAACCTGAGGAAGG - Intronic
997079450 5:130721588-130721610 TAAAATATGAGACTCAAAGAAGG + Intergenic
997202425 5:132019366-132019388 CAAAAAATCAGACTAGAAGAGGG + Intergenic
997985570 5:138498900-138498922 CAAATTATCAAACTTGAAGAGGG - Intergenic
999001815 5:147931948-147931970 CAATTTCTGAGTCTGGAAGAGGG + Intergenic
999695075 5:154181556-154181578 CAAAATATGAAACTCAAAGAAGG - Intronic
999827159 5:155284707-155284729 CAAAATATGAGACTTGAAGAAGG - Intergenic
999909348 5:156180701-156180723 CAAATTATGAGACTTGAAGAGGG + Intronic
1000229720 5:159304210-159304232 CAAAAGATGAGACTCAAAGAAGG + Intergenic
1001047928 5:168389552-168389574 AAGATTCTGAGACTTAAAGAGGG - Intronic
1001294882 5:170492216-170492238 CAAATTATTAGACCTGAGGAAGG - Intronic
1001359568 5:171067992-171068014 CACATTATGAGAATTAAAGAAGG - Intronic
1001838265 5:174850882-174850904 CAAATTATGGGAGTTTAAGCAGG - Intergenic
1002139603 5:177131164-177131186 CAAATTATTAGGTGTGAAGAAGG + Intergenic
1002412587 5:179095006-179095028 CAGATTATTGGACTTAAAGAGGG - Intergenic
1002558098 5:180060040-180060062 CAAAGTCAGAGACTTGAAGATGG + Intronic
1003196679 6:3920879-3920901 CAAATTTTCAAACTTGAGGAGGG + Intergenic
1003274964 6:4642304-4642326 TAAATAATAAGACTTGAAAATGG + Intergenic
1003891080 6:10564346-10564368 CAAATTCAGAGACTTGCAAAGGG - Intronic
1003998034 6:11563584-11563606 CAAATGATGAAACCTGAGGAGGG - Intronic
1004257827 6:14081167-14081189 CAAGGTATGAGACATGAAGAGGG + Intergenic
1004680849 6:17892916-17892938 CAAATTATGGAACCTGAGGAGGG + Intronic
1005410384 6:25539143-25539165 CAAATTATGGAACCTGAAAAAGG + Intronic
1005507714 6:26484258-26484280 CAAAATATGAGACTCAAAGAAGG + Intergenic
1006369855 6:33637293-33637315 CAAATTATTAAACATAAAGAGGG - Intronic
1008233997 6:49021723-49021745 CAAATTATAAGAATTCTAGAAGG - Intergenic
1008433001 6:51442205-51442227 CAAATTAGTAGAATTGAAAAAGG - Intergenic
1008644848 6:53503605-53503627 AAAATTAGGAGACATGAAAAGGG - Intronic
1009530737 6:64811064-64811086 CAAATTATGAGATTTGTTCATGG - Intronic
1009591315 6:65674172-65674194 CACATTATGAGAGTTTTAGAAGG + Intronic
1009604163 6:65845511-65845533 CTAATTATGATCCTTGAAAAAGG + Intergenic
1010574053 6:77510572-77510594 CAAATTAGGGCACTTTAAGAAGG - Intergenic
1011355355 6:86467727-86467749 GAAAATATGATACTGGAAGAAGG + Intergenic
1011824945 6:91294947-91294969 CAAAATATGAGACTCAAGGAAGG + Intergenic
1012242388 6:96888371-96888393 CAAACTAAGATACTTGAAAAGGG - Intergenic
1012930148 6:105308123-105308145 CAAATACTGAGAAGTGAAGAAGG + Intronic
1013507847 6:110816937-110816959 CAAAATATGAGACTCAAAGAAGG - Intronic
1013572418 6:111442396-111442418 CATATTATCAGAATTAAAGAGGG - Intronic
1014400943 6:120988810-120988832 CATTTTCTGAGAATTGAAGAAGG + Intergenic
1015065413 6:129020421-129020443 CAAAGTATGAGACTTAAAGAGGG + Intronic
1015248791 6:131105036-131105058 CAAATTATAAAACCTGAGGAAGG + Intergenic
1017169387 6:151441865-151441887 CAAATAATCAAACCTGAAGAGGG + Intronic
1018201863 6:161402651-161402673 CAGAATATGAGACTCCAAGAAGG + Intronic
1018759845 6:166884399-166884421 CAAATTATCAAACCTGCAGAAGG + Intronic
1019252290 7:23125-23147 CAAATTGTCAAACCTGAAGAGGG - Intergenic
1019851063 7:3558012-3558034 CAAACTATGAGACAGGAACAGGG - Intronic
1019950340 7:4367171-4367193 CAAATTAAAAGACTTTAATATGG + Intergenic
1020330689 7:7013942-7013964 CAAATTATCAAACATGGAGAGGG + Intergenic
1020580051 7:9986088-9986110 CAATTTATGCAACTTGAAGATGG + Intergenic
1020595842 7:10206031-10206053 CAAATTATCAGAATAGAATAAGG - Intergenic
1020800380 7:12725474-12725496 CATATTATTAAACTTGAAAAGGG + Intergenic
1021105793 7:16638334-16638356 CAAATTATGGAACCTGAGGAGGG - Intronic
1022131994 7:27413227-27413249 CTATTTATAAGACTTTAAGAAGG - Intergenic
1022434545 7:30369439-30369461 CAAGTTAGGAGAGTGGAAGAGGG + Intronic
1022718042 7:32916352-32916374 TGACTGATGAGACTTGAAGAAGG + Intergenic
1023108275 7:36784887-36784909 CAAAATATGAGACTGAAAGATGG + Intergenic
1023322725 7:39016841-39016863 CAGTTTAAGGGACTTGAAGAAGG + Intronic
1023660333 7:42464866-42464888 CAGTTGATGAGACATGAAGAAGG - Intergenic
1023698238 7:42869206-42869228 CAAATAAGGAGAATTGAAGGGGG - Intergenic
1024050235 7:45616270-45616292 CAATTTTGGAGACTTGGAGAAGG - Intronic
1024411421 7:49047325-49047347 TAAATTAAGAGTCTTGAAGAGGG - Intergenic
1024513721 7:50224814-50224836 CAAATTCTGAAACTAGATGATGG + Intergenic
1024858181 7:53806039-53806061 GAAATTATAAGACCTGAGGAGGG - Intergenic
1027515592 7:79137989-79138011 GAAATGATGAGCTTTGAAGATGG + Intronic
1027525857 7:79267765-79267787 CAAAATTTGAGACTCAAAGAGGG + Intronic
1027977857 7:85181822-85181844 AAAATTATGAAACATGAACATGG + Intronic
1028136223 7:87225843-87225865 CAAATCATCAAACTTGAGGAAGG + Intergenic
1028235940 7:88361548-88361570 CAAATGATGAAACCTGAGGAGGG + Intergenic
1028280138 7:88914408-88914430 AAAAACATGTGACTTGAAGAGGG + Intronic
1028492751 7:91431912-91431934 CAAATTATACGATTTGAAAATGG - Intergenic
1028728948 7:94122652-94122674 AAAATTATGAGACTTTGAGCGGG - Intergenic
1029914209 7:104189830-104189852 CAAATTATCAAACCTGAGGAGGG + Intronic
1030038102 7:105425212-105425234 TAAATAATGAGACTTGAGGCCGG + Intergenic
1030646225 7:112064681-112064703 CAACTTCTGAGTCTTGAAGGGGG - Intronic
1031136757 7:117892976-117892998 CAAAATATGAGGCTCAAAGAAGG - Intergenic
1033176063 7:139124777-139124799 CAAAATATGAGATTCAAAGAAGG - Intergenic
1033224530 7:139550135-139550157 CAAAGTAGGAAACTTGCAGATGG + Intergenic
1033960971 7:146912637-146912659 TAAATTATGAGATTAGAATAAGG - Intronic
1034031951 7:147777195-147777217 ATAATTTTTAGACTTGAAGAAGG - Intronic
1034927077 7:155131059-155131081 CAAATTATCAAACTTAAAGATGG - Intergenic
1035747296 8:1971570-1971592 CAAATCACAAGACTTGCAGAGGG + Intergenic
1035957580 8:4099239-4099261 CAAAGAAAGACACTTGAAGAGGG - Intronic
1036047564 8:5160703-5160725 AAAAATAAGAGACTTGAGGAAGG - Intergenic
1036391609 8:8328931-8328953 TAAATTATGATACTTGCATATGG - Intronic
1036615907 8:10387432-10387454 CAAACTATGAGACTCTAAGAAGG + Intronic
1036718965 8:11154550-11154572 CAAATTGTCAGACCTGAAGGTGG + Intronic
1037281938 8:17251075-17251097 CAAAGTATGGGCCTTGCAGAGGG - Intronic
1037429915 8:18800208-18800230 CATATTCTTAGATTTGAAGAAGG + Intronic
1037736618 8:21572069-21572091 CAAATTATGAAACCTGAGGATGG + Intergenic
1039234988 8:35492635-35492657 CAAAATATGAGACTCAAAGAAGG + Intronic
1039291690 8:36102169-36102191 CAAATTATGTAATTTCAAGAAGG - Intergenic
1039727066 8:40229792-40229814 TAAAATATGAGACTCAAAGAAGG - Intergenic
1039790287 8:40870337-40870359 CCAAATATGAGACTTGAGGAAGG - Intronic
1039909394 8:41812330-41812352 CAAAATATGAGACTCAAAGAAGG + Intronic
1039910250 8:41820791-41820813 CAAAATATGAGACTTGATGAAGG + Intronic
1040356746 8:46625784-46625806 CAAATTATCAAACATGAAGAGGG + Intergenic
1041437815 8:57861713-57861735 AAAAATATGAGACTTCAGGAAGG + Intergenic
1041811208 8:61912664-61912686 CAAATTAGCATACTTAAAGAAGG + Intergenic
1041911032 8:63088278-63088300 CAAAGTATGAGACTTAAAGAAGG + Intergenic
1042281413 8:67060663-67060685 CATATTATGACAAATGAAGATGG + Intronic
1042657751 8:71118951-71118973 AAAAATATAAAACTTGAAGAAGG - Intergenic
1042973248 8:74434096-74434118 CAAATTATTAAACCTGAGGATGG + Intronic
1043132082 8:76474200-76474222 CACAAAATGAGACTTGAAGAAGG + Intergenic
1044325250 8:90851301-90851323 CAAATTATCAAACCTGAGGAGGG + Intronic
1045202453 8:99998356-99998378 CAATTTATGAAACTTAAAGGTGG + Intronic
1045466140 8:102471543-102471565 CAAATCAGTAAACTTGAAGATGG + Intergenic
1045869065 8:106904725-106904747 CAAATTATGGAACTTGAGAAGGG - Intergenic
1047047684 8:121073200-121073222 CAAATTCTCAAACCTGAAGAAGG + Intergenic
1048388972 8:133942418-133942440 CAACTTATGAACCTTGAAGATGG - Intergenic
1048427742 8:134338464-134338486 CAAATTATCAAACCTGAGGAGGG - Intergenic
1048867493 8:138771480-138771502 TAAATTATCAGACTTGGAAAGGG - Intronic
1050236757 9:3589713-3589735 CTAATGATTAGACTTGAGGATGG + Intergenic
1050392915 9:5165593-5165615 CAAATTATCAAATTTGAAAATGG - Intronic
1050491517 9:6193465-6193487 GAAATTATCTGATTTGAAGAAGG + Intergenic
1050500552 9:6293737-6293759 CAAATTATGGAACCTGAAGAGGG - Intergenic
1051227485 9:14916784-14916806 CAAATTTGGAGACTGTAAGATGG - Intergenic
1053476238 9:38383959-38383981 CAGATTATCAGATTTGGAGAGGG + Intergenic
1053694050 9:40619004-40619026 CAAAGTATAAGACTTGAAGATGG - Intergenic
1053852209 9:42300600-42300622 AAAAATATGAGACTCAAAGAAGG + Intergenic
1053941041 9:43249423-43249445 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054270785 9:63021123-63021145 CAAAGTATAAGACTTGAAGACGG + Intergenic
1054305295 9:63418228-63418250 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054404042 9:64742217-64742239 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054437663 9:65227717-65227739 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054492740 9:65794250-65794272 CAAAGTATAAGACTTGAAGACGG + Intergenic
1055521196 9:77082561-77082583 CAAAGTTTGAGACTCAAAGAAGG - Intergenic
1055524032 9:77111775-77111797 CAAAATATGAGAATCAAAGAAGG - Intergenic
1056018888 9:82421585-82421607 CAAACTCCCAGACTTGAAGATGG - Intergenic
1056315259 9:85382367-85382389 CACATTACAAGCCTTGAAGAGGG - Intergenic
1056413965 9:86358670-86358692 CAAAGTATGAAACTCAAAGAAGG + Intergenic
1058833219 9:108837838-108837860 CAAATTATCAAACCTGAAGAAGG + Intergenic
1059219375 9:112598579-112598601 CAGATTTTAAGACTTGAATAAGG - Intronic
1060840882 9:126792262-126792284 CTAATTGGGAGACTTGAAGCAGG + Intergenic
1062748052 9:138228790-138228812 CAAATTGTCAAACCTGAAGAGGG + Intergenic
1203427032 Un_GL000195v1:50781-50803 CAAATTATTTAACTTGAAAAGGG + Intergenic
1203439172 Un_GL000195v1:172287-172309 CAAATTATTTAACTTGAAAAGGG - Intergenic
1186248493 X:7640406-7640428 CAAAATATGAGACTCAAAGAAGG + Intergenic
1186801730 X:13099516-13099538 CAAAATATGATACTAAAAGAAGG + Intergenic
1187355967 X:18572101-18572123 TAGATTATTAGACTTGAAAAAGG + Intronic
1187937788 X:24352801-24352823 CAAATTGTCAGACTTGAAGGTGG + Intergenic
1188330650 X:28867008-28867030 GACAATATGAGAGTTGAAGAAGG + Intronic
1188416854 X:29945686-29945708 CATTTTATCAGACTTGCAGATGG + Intronic
1188430550 X:30101991-30102013 CAAAGTATGATAGTTGAAGAAGG - Intergenic
1188455601 X:30361797-30361819 CCAATGATGAAACTTGCAGAAGG - Intergenic
1188800535 X:34524485-34524507 CAATTTATCAAACTTGAGGAGGG + Intergenic
1188911295 X:35851218-35851240 CAAAATATGAAACTCAAAGAAGG + Intergenic
1190417180 X:50191498-50191520 AAAAGTATGAGACTTGGAGTAGG + Intronic
1190504181 X:51109711-51109733 CAAAATGTGAGACTGCAAGAAGG - Intergenic
1191980129 X:66916404-66916426 CAAATTAGGAGAATTAAAGAAGG - Intergenic
1192276817 X:69640573-69640595 CAACTTATGAGAGGGGAAGATGG - Intronic
1192323055 X:70107761-70107783 CAAACTATGAGACTTCAAGAAGG + Intergenic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1192972660 X:76250383-76250405 CAATTTATGAGAAATTAAGAAGG - Intergenic
1194322285 X:92463724-92463746 AAAAAAATGAGACTTGAAGGTGG + Intronic
1194613537 X:96073734-96073756 AAAATTATTAGAGTTGTAGAAGG - Intergenic
1194796992 X:98224003-98224025 CAAATTTTAAGGTTTGAAGATGG + Intergenic
1195564475 X:106324858-106324880 CAAGTTATAAGAGTTCAAGAAGG + Intergenic
1196036974 X:111156070-111156092 CAAATGGTGAGACTGGATGAAGG + Intronic
1196492604 X:116286169-116286191 CAAAATATGAGACTTACAGAGGG + Intergenic
1197143915 X:123149453-123149475 CAAATTATCAAACCTGAGGAGGG - Intergenic
1197853045 X:130884326-130884348 CTGTTTATGAGACTTTAAGATGG - Intronic
1198853341 X:140989481-140989503 CAAAATATGGAACTTAAAGATGG - Intergenic
1200630441 Y:5577201-5577223 AAAAAAATGAGACTTGAAGGTGG + Intronic
1201191821 Y:11450557-11450579 CAAAGTATAAGACTTGAAGATGG - Intergenic
1201767571 Y:17586843-17586865 GAAAGTATGAGTATTGAAGAAGG - Intergenic
1201833982 Y:18319142-18319164 GAAAGTATGAGTATTGAAGAAGG + Intergenic