ID: 999910791

View in Genome Browser
Species Human (GRCh38)
Location 5:156196270-156196292
Sequence CAAGAATCCTCCCTTTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999910791 Original CRISPR CAAGAATCCTCCCTTTATAT GGG (reversed) Intronic
902553506 1:17233249-17233271 CCAGAAACCTGCCTTTTTATGGG - Intronic
902894795 1:19471956-19471978 CAAGGATCCTACTTTTATCTTGG - Intronic
903405885 1:23095626-23095648 CAATAATCCTTGCTTTAGATTGG - Intronic
907108119 1:51902479-51902501 CTAGAGGCCTCCCTTTCTATAGG + Intergenic
908016748 1:59847586-59847608 CAAGAATCCTAACTTTTTTTGGG + Intronic
909719128 1:78746624-78746646 CAATAATTCTACCTTTATGTAGG - Intergenic
916996435 1:170306832-170306854 AAAGGCTTCTCCCTTTATATGGG - Intergenic
917131090 1:171742551-171742573 CCAGGCTCCTCCCTTTAGATAGG + Intergenic
917240248 1:172940384-172940406 GAAGTAGCCTCCCCTTATATGGG - Intergenic
918095727 1:181332534-181332556 CAAGAATCCTCTATGTTTATAGG - Intergenic
920814091 1:209314838-209314860 CAGAAATATTCCCTTTATATTGG + Intergenic
922708315 1:227805291-227805313 CATGAATTCTCTCTTTATCTGGG + Intergenic
924107561 1:240664705-240664727 AAAGACTCCTCCATTTATAGAGG - Intergenic
1063808650 10:9678310-9678332 CAAGAATTCTACATTTATATTGG + Intergenic
1072677493 10:97479104-97479126 GAAGAATCTTCCCTGTATAGAGG - Intronic
1074425366 10:113346640-113346662 CAAGAATCCTCACTTTCAACAGG + Intergenic
1075971833 10:126661302-126661324 CAAGGCTCAACCCTTTATATAGG + Intronic
1075972211 10:126664389-126664411 CAAGACTTAACCCTTTATATAGG + Intronic
1078147072 11:8729408-8729430 CAATAATCCCCTCTTGATATAGG + Intronic
1078235069 11:9477019-9477041 AAAGATTCCTCCCTTTGTTTGGG - Intronic
1087541370 11:99525132-99525154 AAAAAAGCCTCCCTTTAAATTGG - Intronic
1092020390 12:5197762-5197784 CAAAAATACTCCCTTTAGCTGGG + Intergenic
1092554053 12:9536961-9536983 GCAGAATCCTACCTTTACATAGG + Intergenic
1094518045 12:31153667-31153689 GCAGAATCCTACCTTTACATAGG - Intergenic
1094584576 12:31766004-31766026 CAAAAAGCTTCCCTTTTTATAGG + Intergenic
1100791798 12:98138419-98138441 TAAGAATCCTTTCTTTTTATGGG + Intergenic
1102894837 12:116590499-116590521 CAAGAATCGTATCTCTATATGGG - Intergenic
1103711695 12:122917643-122917665 AAAGAATCTTCCCTTTCTTTAGG + Intergenic
1112025868 13:95410466-95410488 CCAGAATCCTCTCTTGTTATTGG - Intergenic
1114176676 14:20327399-20327421 AGAAAATCTTCCCTTTATATAGG + Intronic
1117705667 14:58464825-58464847 CATGAATCATCCCTTTGTCTGGG - Intronic
1118041191 14:61918970-61918992 TAAGAATCCTCCCCATATGTTGG - Intergenic
1119938948 14:78619873-78619895 CAAGAGTCTTCCCTTTTTCTCGG + Intronic
1120098303 14:80414708-80414730 AAAGGACACTCCCTTTATATTGG + Intergenic
1120458250 14:84759733-84759755 AAAGAATCCTCCCCTTTTCTTGG + Intergenic
1121281447 14:92702008-92702030 CATGAATCCTCCCTTTGTCCGGG + Intergenic
1121687986 14:95853696-95853718 CAAGAAGACTCCATTTATTTAGG - Intergenic
1122551336 14:102551806-102551828 CAAGAATCCTCCCTCTCTTGGGG + Intergenic
1125076978 15:35630893-35630915 CATGAATCCTTTCTTTATTTTGG + Intergenic
1126758727 15:51949808-51949830 CTCGAATGCCCCCTTTATATCGG + Exonic
1127896739 15:63306990-63307012 CCAGAATTTTCCCTTTATAAAGG - Exonic
1130767343 15:86884295-86884317 CATGAATCCTCCCTTTGTCCAGG - Intronic
1138297468 16:55899294-55899316 CAGGAAGCCTCCCATTATAATGG - Intronic
1140869067 16:79090177-79090199 CAAGAAACAGCCCTTTTTATGGG - Intronic
1141308184 16:82887059-82887081 CTAGAAGCCTCCTTTTAAATAGG + Intronic
1142908062 17:3061871-3061893 CCAGAATCCTCCCCTTCTACTGG + Intergenic
1142926503 17:3242390-3242412 CCAGAATCCTCCCCTTCTACTGG - Intergenic
1144596603 17:16575188-16575210 CAATAATCCACCCTCTGTATTGG - Intergenic
1149914207 17:60593600-60593622 CAAGCTTCCTCTCTTTAAATAGG + Intergenic
1150327425 17:64268273-64268295 CCAGAATCCTCCCTCTCCATCGG - Intergenic
1151723084 17:75869418-75869440 CAAGAATCATCCCTTTGTTCGGG + Intergenic
1157970622 18:52263472-52263494 CAAGAATCCCTCCCTTATATAGG - Intergenic
1159624095 18:70671461-70671483 CATGAATCCTCCTCTTTTATAGG + Intergenic
1164282964 19:23785347-23785369 GCAGAAGCCTCCCTTTTTATAGG - Intronic
1167686947 19:50962455-50962477 CATGGATCCTCCCTTTCTATTGG + Intronic
927894036 2:26770036-26770058 CAAGGATCCTCATTTTAGATGGG - Intronic
928318258 2:30262799-30262821 CAAGGATCCTCTCTTTAAAGAGG - Intronic
931701865 2:64915751-64915773 AAAGAATCATCCCTTTTTATGGG - Intergenic
932667057 2:73706546-73706568 CAAGACTCATCCCTTTATTCAGG - Intergenic
932669059 2:73720887-73720909 CAAGACTCATCCCTTTATTCAGG - Intergenic
933184363 2:79262130-79262152 TAAGAATCCTCTCTTTATTCAGG - Intronic
939918493 2:148078848-148078870 CAATAATCCTGACTTTATGTTGG + Intronic
941250924 2:163161422-163161444 CAAGAATACTACTTTCATATTGG - Intergenic
942414991 2:175749097-175749119 CAAGACTCCTCACTTTCTCTGGG - Intergenic
948288763 2:236808590-236808612 AAAGACTCCTCCCTTGATTTTGG + Intergenic
948618481 2:239217037-239217059 CAAGGAGGCTCCCTTTCTATAGG - Intronic
1169756737 20:9050846-9050868 CAACATTCATCACTTTATATTGG + Intergenic
1175601432 20:60276890-60276912 CAAGAAACCTCCCTTTGTCTTGG - Intergenic
1178200459 21:30397148-30397170 CAAGAATCCACATTTTATAAGGG - Intronic
959100566 3:102004644-102004666 CAATAATCTGCCCTTTATTTTGG - Intergenic
963860096 3:150300591-150300613 CATGAATCATCCCTTTGTCTAGG - Intergenic
965893705 3:173546746-173546768 CAAGAATCATTCCTTTACACAGG + Intronic
966937730 3:184724658-184724680 CAAGGATCCTCCCTGTGTCTTGG + Intergenic
970133844 4:12900357-12900379 CAAGAATTCTCCCATAATCTTGG + Intergenic
970163665 4:13214439-13214461 CAAAAATCCTCACTTTAGACAGG + Intergenic
970317747 4:14845599-14845621 CAAGAATCCTTCCTTTTTTTGGG - Intergenic
970500814 4:16674859-16674881 CAAGTATACTCCCTTAACATTGG - Intronic
970513762 4:16806688-16806710 CAAGAATCTTCCCCAAATATTGG + Intronic
970606453 4:17686381-17686403 CAAGGATTCTCCCTTAATCTGGG + Intronic
974719471 4:65718690-65718712 GAATAATCCTCCCTACATATTGG - Intergenic
977443784 4:97102331-97102353 CCAGACTCATCCCTTTATTTTGG - Intergenic
987261741 5:16211212-16211234 GAAAAATCCTCCCTTCTTATAGG - Intergenic
988932491 5:36050249-36050271 AAAGAATCGTCCCTTTGCATAGG - Intronic
989071498 5:37516551-37516573 CATAAATTCTCCCTTTATTTTGG - Exonic
992432486 5:76722654-76722676 CAAGAATTCTACCTTTAGGTTGG + Intronic
994721929 5:103390382-103390404 CAAGAATAGTCCCTTTTTAGAGG - Intergenic
995051758 5:107714952-107714974 CAACACTCCTCCCTTATTATCGG + Intergenic
995241520 5:109890284-109890306 CAAGAAATCTCCCTTTGTAAGGG - Intergenic
995689174 5:114804240-114804262 CCAAAATCCTCCCTTTCAATTGG + Intergenic
996254596 5:121383814-121383836 CTAGAATCATTACTTTATATGGG - Intergenic
999910791 5:156196270-156196292 CAAGAATCCTCCCTTTATATGGG - Intronic
1003362538 6:5442272-5442294 CAGGAATTCTACATTTATATCGG + Intronic
1004248725 6:14004567-14004589 GAAGCATCCTCCCTTCAGATGGG - Intergenic
1006837624 6:37008538-37008560 CAGGAATCCTTTCTGTATATAGG - Intronic
1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG + Intergenic
1012229310 6:96741753-96741775 AAAGTTTCCTCCCTTTATCTAGG - Intergenic
1012437802 6:99233696-99233718 CAACAATCTTCCATTTATTTTGG - Intergenic
1014477638 6:121893097-121893119 CAAGAAGCCATCCTTTATAGAGG - Intergenic
1018568767 6:165185251-165185273 CAAGAATCTTTCCTTTTTCTAGG - Intergenic
1020419714 7:7987994-7988016 CAAGAAGACTCCCATTATCTTGG - Intronic
1021030293 7:15724471-15724493 CAATGATCCTTCCTTTTTATTGG - Intergenic
1021813739 7:24427737-24427759 CTGGATTTCTCCCTTTATATGGG + Intergenic
1024489920 7:49969429-49969451 AAATAATCTTCTCTTTATATTGG - Intronic
1028918603 7:96286950-96286972 GAAGAATCCTCTCTTTACACAGG + Intronic
1030439421 7:109568478-109568500 CAAAAATTCTTCCTTTTTATTGG + Intergenic
1032131453 7:129232006-129232028 CAAATACCCTTCCTTTATATAGG - Intronic
1034514704 7:151566562-151566584 CAAAAATCCACCTTTTATAAAGG + Intronic
1038623496 8:29167817-29167839 CATGAAACCTACCTTTATTTCGG + Intronic
1040381879 8:46881021-46881043 CTAGACTCATCCCTTTATTTTGG + Intergenic
1041403380 8:57468555-57468577 CTAGAATACTCCCATTTTATAGG - Intergenic
1041407707 8:57518307-57518329 CAAGAATACTGCCTTGTTATGGG + Intergenic
1041527201 8:58820480-58820502 CAATAATGCTGCCTTTATTTGGG + Intronic
1041981874 8:63871667-63871689 CAAGAATCCTCCCAATCTAGAGG + Intergenic
1047035222 8:120930974-120930996 TAATTCTCCTCCCTTTATATGGG + Intergenic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1057103151 9:92383278-92383300 CAAGATTCTTCTCTTTATTTGGG + Intronic
1057390124 9:94635880-94635902 CAAGAAACATCCATTAATATCGG - Intronic
1058603524 9:106696756-106696778 AAAAAATTCTCCCTTTCTATTGG - Intergenic
1060534326 9:124371625-124371647 TAAAAATCCTTCCTTTATCTAGG - Intronic
1060788910 9:126472286-126472308 CCTGCATCCTCCCTTCATATGGG - Intronic
1185925388 X:4140010-4140032 CAAATATCCTCCCCTTATTTGGG + Intergenic
1187041990 X:15606377-15606399 CTAGAAACCTCCCTTTTCATAGG + Intergenic
1188626591 X:32292565-32292587 CAAGAATATTCCCTTTGTTTTGG - Intronic
1189034037 X:37478147-37478169 AAAGAATCACTCCTTTATATAGG + Intronic
1189618205 X:42807300-42807322 CAAAAATCATCCCTTTAGAAGGG - Intergenic
1195484282 X:105385392-105385414 CAAGAATCCTCTGTTTATAAGGG + Intronic
1195942448 X:110177256-110177278 AAAGAATCTTTCATTTATATTGG + Exonic
1195968240 X:110448605-110448627 CCAGATTCCTGCCTCTATATAGG - Intronic
1200843496 Y:7807932-7807954 CAATAATTTTCCCTTTATTTAGG + Intergenic
1202350784 Y:23988585-23988607 CAAGAAGCCTTCTTTTCTATTGG + Intergenic
1202519995 Y:25681535-25681557 CAAGAAGCCTTCTTTTCTATTGG - Intergenic