ID: 999910861

View in Genome Browser
Species Human (GRCh38)
Location 5:156197315-156197337
Sequence GTGTTTCAAACTAATCCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999910861_999910862 16 Left 999910861 5:156197315-156197337 CCTCACGGATTAGTTTGAAACAC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 999910862 5:156197354-156197376 ATATTTCTCACCTAATTCATAGG 0: 1
1: 0
2: 3
3: 19
4: 267
999910861_999910864 26 Left 999910861 5:156197315-156197337 CCTCACGGATTAGTTTGAAACAC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 999910864 5:156197364-156197386 CCTAATTCATAGGACTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999910861 Original CRISPR GTGTTTCAAACTAATCCGTG AGG (reversed) Intronic
923201297 1:231714860-231714882 TTGTTTCAAATGAATCCATGTGG - Intronic
1071739579 10:88341828-88341850 CTATTTCATACTAATCTGTGAGG + Intronic
1074216672 10:111391732-111391754 GTGTTAAAAACTATTCCCTGGGG + Intergenic
1075788904 10:125069296-125069318 GTGTTTGAAACTCATCATTGTGG - Intronic
1077468966 11:2747919-2747941 GTGTTTCAAAACAATCCCTCTGG + Intronic
1083497315 11:63068223-63068245 TCGTTTGAAACTAATCTGTGAGG + Intergenic
1097714133 12:62947559-62947581 GTGTGTCTAAGTAGTCCGTGTGG + Intergenic
1098974881 12:76892164-76892186 GAGTTTCTAATTAATGCGTGTGG - Intergenic
1099981257 12:89606066-89606088 CTGTTTCAACCTGATCTGTGTGG - Intronic
1100875659 12:98959233-98959255 GTGAATCAAAATAATCAGTGTGG - Intronic
1106183608 13:27388638-27388660 GTATTTCAAAATAATCGGAGTGG - Intergenic
1107471842 13:40698287-40698309 TTGTTTCAAAATAATCCAGGAGG - Intergenic
1114278141 14:21166583-21166605 GTTGTTCAAACTATTCCGAGGGG - Intergenic
1116941277 14:50793314-50793336 GTGTTTCAGACTAATTGATGTGG - Intronic
1118382675 14:65230111-65230133 GTGTCTGCAACTGATCCGTGTGG + Intergenic
1127473077 15:59307915-59307937 GAGTTTAAAACAAATCCTTGGGG + Intronic
1131082303 15:89546953-89546975 TTATCTCAAACTCATCCGTGGGG - Intergenic
1138167163 16:54813833-54813855 GTGTTTCAAACTAGGCATTGGGG + Intergenic
1145099662 17:20064081-20064103 GGGTTTCAGACTAGTCAGTGAGG + Intronic
1150127387 17:62646771-62646793 TTGTTTCAAACTTAACCCTGCGG - Intronic
1151176758 17:72294995-72295017 GTGTATCAAACTATTGTGTGCGG + Intergenic
1155263138 18:24064699-24064721 GTGTTTGAAAGTAATTTGTGTGG - Intronic
1157042443 18:44056688-44056710 GTTTTTCAAACTAAACTGTTTGG - Intergenic
1157117862 18:44879280-44879302 GTGATTCAAACTTATCAGTTTGG - Intronic
928266585 2:29817196-29817218 GTGTGTCACACTAAGCGGTGGGG + Intronic
929716972 2:44322129-44322151 GGGTTTCAACCTTGTCCGTGTGG - Intronic
931601149 2:64004394-64004416 GTGTTGCTAAGTAATCTGTGAGG - Intronic
933170130 2:79115638-79115660 GTGTTTCTGACTATTCAGTGAGG + Intergenic
935322565 2:101903064-101903086 TTGTTTCAAACTAAGCCATGAGG - Intergenic
936731736 2:115389706-115389728 GTGGCTCAACCTAATGCGTGAGG + Intronic
948286130 2:236786917-236786939 ATGTCTCAAATTAATCAGTGTGG + Intergenic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
954238791 3:49277253-49277275 GACCTTCAACCTAATCCGTGGGG - Exonic
957202664 3:77157085-77157107 GTGTATCAAACTCATCTGTAGGG - Intronic
957918620 3:86718852-86718874 GTGGTTCAAACAAATCCTTTTGG - Intergenic
969512388 4:7626395-7626417 GTGTTTCACACTAGGCCATGTGG + Intronic
990645227 5:57836367-57836389 TTGTTTCATACTATTCCCTGGGG + Intergenic
992149078 5:73883915-73883937 GTGTTTAAAACTAATAAGAGGGG - Intronic
992270362 5:75056517-75056539 GTGATTCAAACACATCTGTGAGG + Intergenic
999910861 5:156197315-156197337 GTGTTTCAAACTAATCCGTGAGG - Intronic
1005169476 6:22966205-22966227 GTTGTTAAAACCAATCCGTGAGG - Intergenic
1011977493 6:93322757-93322779 GTGATTCAAATAAATCCCTGAGG + Intronic
1012739857 6:103002671-103002693 GTGTTTCAAACTGATACTAGAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1016404185 6:143713305-143713327 TTGTTTCAAAATAATCCTGGAGG + Intronic
1024653419 7:51428511-51428533 GTGTTGGAAACTACTCCATGGGG + Intergenic
1033149401 7:138900110-138900132 GTGTTACAAACCCATACGTGTGG - Intronic
1042987830 8:74603752-74603774 GTGTGTCAAACAGATCTGTGTGG - Intronic
1044288005 8:90431944-90431966 ATCTTTCAAAGTAATCCATGAGG - Intergenic
1048745736 8:137613351-137613373 GTCTTTAAAACTGATACGTGGGG + Intergenic
1061029160 9:128069050-128069072 GGGTTTCAGGCTGATCCGTGTGG + Intronic
1061739279 9:132688240-132688262 GTGTTTCAAAATAATCCATCAGG - Intronic
1187431261 X:19227432-19227454 GTGTTACATACGTATCCGTGAGG - Intergenic
1192231246 X:69266578-69266600 GTGTTTCAATCTAATCCCCAAGG + Intergenic
1198363328 X:135916974-135916996 ATGTCCCAAACTAATCCGTAGGG - Intergenic