ID: 999914760

View in Genome Browser
Species Human (GRCh38)
Location 5:156245690-156245712
Sequence ATCCCCATGGTGTTATTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999914760_999914762 1 Left 999914760 5:156245690-156245712 CCATTAAATAACACCATGGGGAT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 999914762 5:156245714-156245736 CAACCAACCAAAGTCCAGAATGG 0: 1
1: 0
2: 0
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999914760 Original CRISPR ATCCCCATGGTGTTATTTAA TGG (reversed) Intronic
903073414 1:20741547-20741569 ATCCACATGGACTTAATTAAAGG - Intergenic
903406420 1:23100677-23100699 ATCCCCTTGGGGTCATTTAGGGG + Intronic
911552744 1:99304158-99304180 ATCACCATGGTATTATATATGGG - Intronic
913365493 1:118033470-118033492 ATTCCCATTGTCTTATTTCAGGG + Intronic
916495944 1:165346847-165346869 ATGGCCCTGGTGTTAATTAACGG - Intronic
918429403 1:184443578-184443600 GTCTACTTGGTGTTATTTAAGGG + Intronic
1063811553 10:9715067-9715089 ATCCCTATGTAGTTATTTTATGG - Intergenic
1067843449 10:49700211-49700233 ATTCCCATGTTCTGATTTAATGG + Intronic
1068773186 10:60844998-60845020 ATCCACTTGGGGTCATTTAATGG + Intergenic
1070527247 10:77305882-77305904 ATCCCCATGATGTCATTTTATGG - Intronic
1071813050 10:89204341-89204363 ATCCCTATGGTGTTGTTGTAAGG + Intergenic
1072255581 10:93617292-93617314 ATCCCCATCCTGTAACTTAATGG + Intronic
1073911803 10:108354128-108354150 ATCCTCATTGTGTTACTTACCGG - Intergenic
1077830965 11:5869600-5869622 ATATACATAGTGTTATTTAAGGG - Intronic
1080529195 11:33158002-33158024 ATCCTTAAGGTGTTATTTAATGG + Intronic
1081004732 11:37721444-37721466 ATGCCCAGGGTGTTATAGAAGGG + Intergenic
1081356450 11:42120360-42120382 ATCCCCATAGTGTTATGGGAGGG + Intergenic
1087078214 11:94145111-94145133 ATCCACATGTTGTTACTTGATGG - Intronic
1088086887 11:105992004-105992026 ATCACCATGGTGTTTTTGCACGG + Intergenic
1090918575 11:131188217-131188239 ATCCCCATAGTGATATTATAAGG - Intergenic
1092209143 12:6635211-6635233 ATCCTCATGGTGTGATGTGAAGG + Intronic
1105459736 13:20572570-20572592 ATACGCATGCTGTTATTTCAGGG - Intronic
1114029888 14:18568539-18568561 ATCTCCATGAGGTCATTTAAGGG - Intergenic
1114417330 14:22553608-22553630 TTCCCTTTGGTGTTATTTAAGGG - Intergenic
1116788827 14:49317952-49317974 ATCCCCAATGTGTATTTTAAAGG - Intergenic
1119709770 14:76813077-76813099 GGCCCCATAGTGTTATTCAAAGG + Intronic
1119845301 14:77824933-77824955 ATCTTCAAAGTGTTATTTAATGG + Intronic
1121520367 14:94581948-94581970 GTCCCCATGGCCTTATTTCAGGG - Intronic
1124384313 15:29193856-29193878 ATCCTAATGGTATTTTTTAATGG - Intronic
1125307048 15:38329808-38329830 ATCCCAATGGTGCTTTTAAAAGG - Intronic
1125407130 15:39364237-39364259 TTTCCCATTGTGTCATTTAATGG - Intergenic
1125436948 15:39656309-39656331 ATTATCATAGTGTTATTTAAAGG + Intronic
1130036601 15:80366953-80366975 TACCCCCTGGTGTTATCTAAAGG + Intronic
1130771917 15:86932941-86932963 ATCTCCATGGTGATTTTTTAAGG + Intronic
1132000620 15:98175899-98175921 TTCTCCATGGTCTTGTTTAATGG + Intergenic
1132266029 15:100471464-100471486 AGCCTCATTGTGTTATTAAAGGG - Intronic
1135669321 16:24361726-24361748 GTCCCCATGGTGATCTTTGAGGG - Exonic
1150210974 17:63441320-63441342 ATCCACACAGTGTCATTTAAGGG - Intronic
1151028054 17:70703129-70703151 ATCACCGTGGTGCAATTTAAAGG - Intergenic
1153078464 18:1192964-1192986 ACCCCAATGGTGATATTTTAGGG - Intergenic
1156786618 18:40922850-40922872 ATCCCCACGGAGTCATTTCAGGG + Intergenic
1157820104 18:50760878-50760900 ATCCCCAAGGGGATATTAAAAGG + Intergenic
1165856818 19:38883925-38883947 ATCCCAATGGTGCCACTTAAAGG + Intronic
927359769 2:22219389-22219411 ATCCCCATGGTGATATTAGAAGG + Intergenic
927725502 2:25419358-25419380 CTCCCCATGGTGTTGTAAAATGG - Intronic
929109455 2:38394265-38394287 ATGCCCATGGAGTTACCTAATGG + Intergenic
930902165 2:56520817-56520839 ACCCCCAAGGTGATATTAAAAGG - Intergenic
931280827 2:60790139-60790161 CTCCCCAGAGTGTGATTTAATGG - Intronic
935181205 2:100692634-100692656 ATCACCCTGTTTTTATTTAAAGG - Intergenic
935246999 2:101227230-101227252 CTCCCCATGGTGCTGTCTAATGG - Intronic
935416627 2:102826104-102826126 ATACCCATGGTCCCATTTAATGG - Intronic
936830175 2:116634635-116634657 ACCTCCCTGGTGTTATTAAATGG + Intergenic
941491224 2:166144423-166144445 ATTCCCATGGAGTTTTTTGAGGG + Intergenic
943739498 2:191395872-191395894 ATCCTCATGGTCCTATTAAAAGG + Intronic
945038777 2:205727218-205727240 ATGGCCATGGTGTTTCTTAATGG - Intronic
945142187 2:206698656-206698678 TTCCCTATGGTTTTATTTATGGG + Intronic
948434369 2:237943340-237943362 AGTCCCATGGCGTTATTTAAGGG + Intergenic
948621636 2:239238974-239238996 ATCCACATGCTGTTATCGAACGG - Intronic
948979956 2:241489017-241489039 ATCTCCATGGTGTTTTTGTAAGG - Intronic
1174797537 20:53534793-53534815 ATCCCCATTGTGTGATCTGAAGG + Intergenic
1180454004 22:15495588-15495610 ATCTCCATGAGGTCATTTAAGGG - Intergenic
1181442620 22:22944614-22944636 TTCCCCATGGTTTTATTCAGAGG + Intergenic
1184374367 22:44102487-44102509 CTCCCCAGGGTGTTGTTTCAAGG - Intronic
1184416195 22:44353083-44353105 AGCCCCAGGGTGCTATTGAAGGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950274583 3:11647931-11647953 ATCTACATGGTGTTTCTTAAAGG - Intronic
950878638 3:16302775-16302797 ATCTCCATGCAGTTATTTGATGG + Intronic
951714393 3:25623624-25623646 ATTCCCATGGTTTTAATAAATGG - Exonic
956380804 3:68662639-68662661 ACCCCCAGTGTGTTATTTGAAGG + Intergenic
957930950 3:86877059-86877081 ATCCTCATGTTGTTTCTTAAAGG + Intergenic
962381433 3:134901445-134901467 ATCCCCATGGTGTTGTTTCCTGG + Intronic
965398265 3:168187042-168187064 ATGCCCATGGAGGTATATAAAGG - Intergenic
969318585 4:6396631-6396653 ATACCCATGATCTCATTTAAGGG + Intronic
974016370 4:56652910-56652932 GCCTCCATGGAGTTATTTAAAGG + Intronic
987260024 5:16194058-16194080 ATTCACATGTTGATATTTAATGG - Intergenic
987521922 5:18996821-18996843 ATCCACTTGATTTTATTTAATGG - Intergenic
992902232 5:81308754-81308776 ATACCCAAGGTGCTATTTATTGG - Intronic
994601047 5:101905677-101905699 AACCCCATGCTGTTCTTCAAGGG - Intergenic
995905349 5:117116634-117116656 ATCTCCATCGGGTCATTTAAGGG + Intergenic
996290108 5:121842861-121842883 TTCCCCATAGTGAAATTTAAAGG + Intergenic
996370205 5:122745295-122745317 ATGCCTGTGTTGTTATTTAAAGG + Intergenic
999914760 5:156245690-156245712 ATCCCCATGGTGTTATTTAATGG - Intronic
1000739856 5:164955072-164955094 ATCGCTATGGTGATATTTAAAGG + Intergenic
1002544782 5:179933064-179933086 ATTACCAGGGTGTTATTTAATGG + Intronic
1002544898 5:179934331-179934353 ATTACCAGGGGGTTATTTAATGG - Intronic
1003896475 6:10612572-10612594 ATCCCCATGATTTTATTAAAGGG + Intronic
1006264595 6:32909209-32909231 GTCCCCATGGGTTTACTTAAAGG + Intergenic
1007449346 6:41931318-41931340 CTATCCATGGTGATATTTAATGG + Intronic
1008417248 6:51256295-51256317 AACCCCATGATATTATTTACTGG + Intergenic
1008661874 6:53677121-53677143 ATGACCATTGTGTTTTTTAATGG + Intergenic
1012319476 6:97824876-97824898 GTCTCCATGGTGCTATTTCAGGG + Intergenic
1016214212 6:141576347-141576369 AACTCCATTGTTTTATTTAAGGG - Intergenic
1020557462 7:9688904-9688926 ATCCAGTTGGTTTTATTTAAGGG - Intergenic
1021428461 7:20531252-20531274 ATACCCATGTTTTTATTTCATGG + Intergenic
1023485731 7:40684310-40684332 ATAGTCATGGTGTTGTTTAATGG + Intronic
1023780730 7:43652688-43652710 ATCCCCAAGTTATAATTTAAGGG + Intronic
1024095455 7:45979183-45979205 ATCCACAAGAAGTTATTTAAAGG - Intergenic
1024205708 7:47158558-47158580 ATCAGTATGGTGTTATTTGAAGG + Intergenic
1025826784 7:65017183-65017205 CTCCCCATGGTGTTTGTCAAGGG + Intergenic
1025914335 7:65853632-65853654 CTCCCCATGGTGTTTGTCAAGGG + Intergenic
1025975424 7:66365757-66365779 CTCCCCATGGTGTTTGTCAAGGG - Intronic
1027161696 7:75807337-75807359 ATCCCCACCAGGTTATTTAAGGG + Intergenic
1028928619 7:96388251-96388273 ATCCACAAGGTGTTGATTAATGG - Intergenic
1029144645 7:98437126-98437148 ATCCACATGGTGTCACTGAATGG + Intergenic
1031320369 7:120318587-120318609 AACACCATGGAGTTATTTCAAGG - Intronic
1031656961 7:124368145-124368167 ATCCCCAAAATGTTATTTGAGGG + Intergenic
1036098532 8:5751846-5751868 ATCCACAGGGAGTTATTTCACGG - Intergenic
1038631975 8:29254254-29254276 ATCCACATGATGTTAGATAATGG + Intronic
1043040553 8:75257283-75257305 AGCCCCATTTTCTTATTTAATGG + Intergenic
1043323648 8:79022557-79022579 GTCTCTATGGTGTTATTTAAAGG + Intergenic
1043650160 8:82581247-82581269 ATCCCTATGTTATTATATAATGG - Intergenic
1045490424 8:102664056-102664078 ATCCCTATAGTGTTATATCATGG - Intergenic
1046411276 8:113846456-113846478 ATCTCAATGTTGATATTTAATGG - Intergenic
1047646859 8:126878768-126878790 GTCTCCATGATGTGATTTAAGGG + Intergenic
1052417471 9:28195364-28195386 CTCACCATCTTGTTATTTAAAGG - Intronic
1058254584 9:102744640-102744662 AACCCCATGGTCGTATTTCAAGG + Intergenic
1059639418 9:116202179-116202201 TTTCCCATGATTTTATTTAACGG + Intronic
1186041090 X:5480063-5480085 AGCCCCAGTGTGTTGTTTAAAGG - Intergenic
1186723766 X:12334931-12334953 ATCCGCATAGTGTTATTGAGAGG - Intronic
1190569417 X:51766592-51766614 ATCCCCAGGGTAGTGTTTAAGGG - Intergenic
1192234901 X:69289572-69289594 GACCCCATGGTGTCATTTTATGG - Intergenic
1194136978 X:90157255-90157277 ATCCCAATGGCATTATTCAAAGG + Intergenic
1195431434 X:104793903-104793925 ATCCCCATGTTGTTGATTAGTGG - Intronic
1197415953 X:126172877-126172899 ATTCTCATAATGTTATTTAATGG + Intergenic
1200482717 Y:3727197-3727219 ATCCCAATGGCATTATTCAAAGG + Intergenic